0
Which breeding system reduces genetic variation in a population?
Wiki User
∙ 13y ago
Asexual reproduction.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
How does genetic drift lead to a change in a populations gene pool?
Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s
How does natural selection enhance or reduce the variability of a species?
Natural selection doesn't reduce variation. Variation is regulated by the rate of mutation.Natural selection reduces the chance of bad variation from being passed on and increases the chances for good variation to be passed on.
Contrast gene flow with genetic drift?
Genetic drift is when a population experiences a decrease in variation and population size by chance due to the bottleneck or the founders' effect.For example, a volcanic eruption kills most of the flowers in a nearby area. This bottleneck effect reduces the variety of alleles and traits of the flowers by reducing their number.If a person brings some flowers from a garden to a new garden (the new area must be uninhabited by the same species), this founders' effect will start a new flower population from the migrated flowers' pollen with less variation than the original population, since the person had only brought some of the flowers.Gene flow is the movement of alleles between populations, which may make their gene pools more common.For example, if two areas trade birds by migration, gene flow is the switch of allele frequencies in each population, so each bird population loses a few alleles but gains a few alleles.Gene flow doesn't always involve an exchange in alleles. Gene flow can also occur when only one organism migrates from one population to another.
Why is selective breeding bad?
In general ... the people who do the selecting have no idea what the consequences of their meddling will be. This form of short-sightedness often results in detrimental results. It reduces the amount of variation in a species and many activist groups say that we don't have the right in playing God in choosing the direction of a species' development. Also, too close interbreeding to get desired traits means as well as lowering variation, there is an increased risk of passing on genetic diseases to offspring.
What is the ecological niche of a sand cat?
It is the fact it reduces population of smaller rodents insects and reptiles in its ecostytems
What is a genetic bottleneck and are humans affected by one?
A population bottleneck (or genetic bottleneck) is an evolutionary event in which a significant percentage of a population or species is killed or otherwise prevented from reproducing. This reduces the genetic diversity of the population, and even if the population bounces back in size, it can often show evidence of the past bottleneck by lacking significant variation for its size. A good example is that of the cheetah, whose current population shows almost negligible variation. Humans are not currently experiencing any genetic bottlenecking because the population is increasing. However, there is evidence suggesting that the human population underwent one or more bottlenecks in the past, since its overall genetic diversity is relatively low for its size.
Genetic drift resulting from a disaster that drastically reduces population size is called?
The bottleneck effect.
What effect does a bottleneck have on the allele frequency of a population?
It greatly reduces the total population, which increases the effects of genetic drift on allele frequency.
Does genetic drift increase or decrease genetic variation in populations and why?
It is important to understand that each individual has different genes. Genes can be lost if an individual dies without reproducing. To answer your question: There are two type of effects caused by Genetic Drift. The founder effect happens when a few species inhabit a new territory. If only those species reproduce then there are less genes in the gene pool and that leads to less variation. This can happen if storms sweep birds to a previously uninhabited island. The other effect is the bottleneck effect. This happens if a disease or poaching drastically reduces the number of individuals in a population. Since there are less individuals who can reproduce there are not as many genes that can be passed down.
How does genetic drift lead to a change in a populations gene pool?
Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
What are the three outcomes of meiosis?
Three outcomes of meiosis: it reduces chromosomes to the haploid number, it provides genetic variation, and it ensures the correct distribution of chromosomes into the resulting cells.
Modern travel along with migration reduces the probability of what?
genetic drift
How does natural selection enhance or reduce the variability of a species?
Natural selection doesn't reduce variation. Variation is regulated by the rate of mutation.Natural selection reduces the chance of bad variation from being passed on and increases the chances for good variation to be passed on.
What are the outcomes of mother son mating?
Mother-son mating can result in inbreeding, leading to an increased risk of genetic disorders and health problems in offspring. Inbreeding reduces genetic diversity within the population, making it more susceptible to negative effects of genetic abnormalities. It is generally not recommended due to the potential harm it can cause to future generations.
What is the basis of inbreeding depression?
Inbreeding depression is the reduced fitness of a population caused by inbreeding. Inbreeding reduces genetic diversity, meaning populations are less genetically adaptable - and greatly increases the chances of genetic diseases and disorders. Inbreeding is most commonly associated with reduced reproductive and viability traits.
Contrast gene flow with genetic drift?
Genetic drift is when a population experiences a decrease in variation and population size by chance due to the bottleneck or the founders' effect.For example, a volcanic eruption kills most of the flowers in a nearby area. This bottleneck effect reduces the variety of alleles and traits of the flowers by reducing their number.If a person brings some flowers from a garden to a new garden (the new area must be uninhabited by the same species), this founders' effect will start a new flower population from the migrated flowers' pollen with less variation than the original population, since the person had only brought some of the flowers.Gene flow is the movement of alleles between populations, which may make their gene pools more common.For example, if two areas trade birds by migration, gene flow is the switch of allele frequencies in each population, so each bird population loses a few alleles but gains a few alleles.Gene flow doesn't always involve an exchange in alleles. Gene flow can also occur when only one organism migrates from one population to another.
