answersLogoWhite

0


Best Answer

5' TGACATGCAT 3'

The sequence is complementary and in the correct orientation.

User Avatar

Wiki User

11y ago
This answer is:
User Avatar
More answers
User Avatar

Anonymous

Lvl 1
3y ago

tacgtacagt

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: Which is the complimentary dna sequence to 5' atgcatgtca 3'?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


What is the complimentary sequence of ATCGGCTT?

The complimentary sequence of ATCGGCTT will be TAGCCGAA. Because A pairs with T (2 hydrogen bonds), C pairs with G (3 hydrogen bond).


If the base sequence of the DNA is gtcaggatc what would be the corresponding base sequence of the messenger rna?

The corresponding base sequence of messenger RNA (mRNA) would be caguccuag. This is because RNA replaces thymine (T) with uracil (U) when transcribing DNA, so the corresponding Uracil to Adenine, Guanine to Cytosine, Thymine to Adenine, Cytosine to Guanine and Adenine to Uracil.


Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?

3-gttcacctta-5


If the partial sequence A of rRNA to be detected in environmental engineering system is shown 5'-cggguuagcgcaccgc-3' Design the oligonucleotide probe for the detection of the sequence A only?

8


Convert the following DNA sequence into its RNA equivalent and then using the genetic code convert that RNA sequence into the amino acid sequence 5tacttcttcaagact-3?

DNA Sequence = 5tacttcttcaagact-3 RNA Sequence = 3'-AUGAAGAAGUUCUGA-5'You just switch 5' and 3'T becomes AA becomes UC becomes GG becomes CThere should be no Ts in an RNA sequence.


If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?

If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.


What is mRNA base sequence for ATT?

The DNA segment 3' ATT 5' would be transcribed to the mRNA sequence 5' UAA 3'.


Why is DNA described as complementary?

If you are referring to two random DNA strands, then they may or may not be complimentary as they contain different nucleotides and code for different genes. However, if you are talking about DNA strands that comprise a DNA double-helix, then yes they must be complimentary because the nucleotiside adenosine (A) always binds with thymine (T) and guanine (G) always binds with cytosine (C); this is the only way that a double-helix can be formed.


Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?

5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....


What is attgcat complementary strand sequence?

In DNA: 5' attgcat 3' 3' taacgta 5'


How would the following base sequence be coded for in mrna cag tgc acg?

Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.