0
Add your answer:
Earn +20 pts
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
What is 12p 96 equal?
12p < 96 12p / 12 < 96 / 12 p< 8
What fraction is 12p of rs3?
The fraction is 12p/rs3
What is the value of a queen mother 12p 80th birthday stamp?
12p
Solve the inequality 12p 7 139 A. p 18 B. p 12 C. p 154 D. p 11?
First of all--- is it 12p -/+ 7=139, but I'll do both anyway. 1. 12p-7=139 this means you + 7 to both sides first, to get the variable(p) by itself. so the equation would be 12p=146. Next divide 12 from both sides and it leaves you with p=12.1666 -repeating of course. 2. 12p+7=139 means you subtract 7 from both sides to get 12p by itself again. the equation would then be 12p=132. divide 12 from both sides and you get- p=11(which is one of your answers) :) so the answer is d.11.
12 p plus 7 139?
12p + 7*139 = 12p + 973
12p-15 plus 8-4p equals 89?
12p-15+8-4p = 89 12p-4p = 89+15-8 8p = 96 p = 12
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
WhaT is two fifths of 30p?
12p.
What is 10 percent of 12p?
1.2p
