transcription
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
It checks the DNA for errors
which one of the following strands od DNA in the complement strand to c-c-a-t-c-g
The DNA replication for the given sequence "ttcgagacttagtcggatgtgaagtggtgatt" would involve the separation of the DNA double helix into two strands, with each strand serving as a template for the synthesis of a new complementary strand. This process is carried out by DNA polymerase enzymes, which add complementary nucleotides to the exposed bases on each template strand. As a result, two identical DNA molecules are produced, each containing one original strand and one newly synthesized strand.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
Its the information appertaining to the process from order through manufacture , process and then delivery of a given product
The process where DNA is copied is called DNA replication. During DNA replication, the double-stranded DNA molecule is unwound and each strand serves as a template for the synthesis of a new complementary strand. This process is essential for cell division and passing genetic information to offspring.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The power to manufacture money and declare war is given to congress.
What is a cookie in computer terminology?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
The best way to write business plan is by first downloading business plan template on the internet and following the guidlines given by the template.
Download dark blue background Template Presentation to make your slide enhanced. I suggest SlideEgg to get good results. You will have fine background with catchy text. Template has vivid background with eye-catching. Make use of it to have a elegant presentation. Customizable slides by which you can change your background colour.Dark Blue Wallpaper template is a creative template that can make the best outcome. The template is given that blue and black background which is Aesthetic. The template is given with a text area that you can use for paper presentations and business project presentations. The template is user-friendly and can be edited easily.
According to me,when this strand is transcribed the mRNA formed is not coding for any mino acid that is why this portion of gene is removed from DNA.
It is known as a template. You can have any number of template, each one different to suit many situations, provided each template has been given a different filename.
The complementary DNA strand would be TTCGTT.But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
Pyrotechnics.