0
Verified answer
AGCTACC. Thymine pairs with adenine and cytosine pairs with guanine.
Curtis Strite
Wiki User
∙ 14y agoThe complementary strand of DNA that has the sequence aattcgcg is:
ttaagcgc
Wiki User
∙ 13y agoGuanine (G) is always complementary to Cytosine (C)
and
Adenine (A) to Thymine (T)
GACTAGTATTCCG
CTGATCATAAGGC
Wiki User
∙ 12y agoA binds with T, C binds with G. So:
DNA template - ATCAACCTGGAT
Complementary DNA (replace T with U for RNA) - TAGTTGGACCTA
Wiki User
∙ 9y agoThe complementary sequence to the DNA strand having TCGATGG genes would be AGCTACC. Thymine pairs with adenine and cytocene pairs with guinene.
Wiki User
∙ 9y agoTCGATGG on one strand of DNA will be matched by AGCTACC. This occurs during DNA replication.
Wiki User
∙ 13y agoMy guess is that by being able to posit such a specific question, the questioner probably already knows the answer. Nevertheless, the answer would be as follows:
cttaagccgt
Wiki User
∙ 14y agoccggtaat
Wiki User
∙ 12y agoTAACGG
The direction of synthesis of an RNA transcript is?
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
What is the process of going from DNA to RNA called?
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
What does semi-conservative model mean?
Refers to semi-conservative replication of DNA. One strand of the old DNA is used as a template to replicate the other, new, strand of DNA. Thus you have four from two, but two of the four are old strands while the other two strands are new. Thus the name semi-conservative replication.
Which best describes how scientists found he human gene that makes insulin?
they worked backwards from mRNA to DNA Ap#x
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary base sequence of DNA strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
What would be the base sequence of the complementary mRNA strand?
TGCA
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
What sequence in human DNA is the forward primer complementary to?
forward primers are complementary to anti sense strand of the dsDNA
