0
AGCTACC. Thymine pairs with adenine and cytosine pairs with guanine.
What else can I help you with?
The direction of synthesis of an RNA transcript is?
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
What is the process of going from DNA to RNA called?
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
What does semi-conservative model mean?
Refers to semi-conservative replication of DNA. One strand of the old DNA is used as a template to replicate the other, new, strand of DNA. Thus you have four from two, but two of the four are old strands while the other two strands are new. Thus the name semi-conservative replication.
During which phase does the DNA make a copy of itself?
DNA is replicated in the Synthesis stage of the cell cycle.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
What is the complementary base sequence of DNA strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What would be the base sequence of the complementary mRNA strand?
TGCA
If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
What would be the complementary strand of DNA for the following sequence AATGCTGATTCCCGGATCG?
The complementary strand of DNA for the sequence AATGCTGATTCCCGGATCG would be TTACGACTAAGGGCCTAGC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base to form the new strand.
What is the complementary strand of DNA?
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
