AGCTACC. Thymine pairs with adenine and cytosine pairs with guanine.
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
Refers to semi-conservative replication of DNA. One strand of the old DNA is used as a template to replicate the other, new, strand of DNA. Thus you have four from two, but two of the four are old strands while the other two strands are new. Thus the name semi-conservative replication.
DNA is replicated in the Synthesis stage of the cell cycle.
its tcaa
TGCA
auc
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
TGCA
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
tcaa --remember a attracts t while c attracts g
The 2nd strand matching DNA refers to the strand that can pair with the original DNA sequence through complementary base pairing. In DNA replication, this matching strand is synthesized by DNA polymerase according to the sequence on the original template strand.