AGCTACC. Thymine pairs with adenine and cytosine pairs with guanine.
transcription:"the first step in protein synthesis, a sequence of nucleotide bases becomes exposed in an unwound region of a DNA strand. That sequence acts as a template upon which a single strand of RNA - a transcript - is synthesized from free nucleotides."The synthesis of an RNA molecule from the DNA template strand is called transcription.
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
Refers to semi-conservative replication of DNA. One strand of the old DNA is used as a template to replicate the other, new, strand of DNA. Thus you have four from two, but two of the four are old strands while the other two strands are new. Thus the name semi-conservative replication.
DNA is replicated in the Synthesis stage of the cell cycle.
its tcaa
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
auc
TGCA
TGCA
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.
The complementary strand of DNA for the sequence AATGCTGATTCCCGGATCG would be TTACGACTAAGGGCCTAGC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base to form the new strand.
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.