0
What else can I help you with?
Examples of palindromic DNA sequences?
Some examples of palindromic DNA sequences are "GGTACC" (complementary sequence: "CCTAGG"), "ACGT" (complementary sequence: "TGCA"), and "AGCT" (complementary sequence: "TCGA"). These sequences read the same on both strands when read in the 5' to 3' direction.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
Examples of palindromic DNA sequences?
Some examples of palindromic DNA sequences are "GGTACC" (complementary sequence: "CCTAGG"), "ACGT" (complementary sequence: "TGCA"), and "AGCT" (complementary sequence: "TCGA"). These sequences read the same on both strands when read in the 5' to 3' direction.
What are base sequences in tRNA called?
Anticodons
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the structure of Double stranded DNA molecule in palindromic sequence?
A palindromic DNA sequence is one where the nucleotide sequence reads the same forwards and backwards on both strands. In the double-stranded DNA molecule, the two strands are complementary and run anti-parallel to each other. This means that the palindromic sequence on one strand will have its complementary sequence on the other strand.
What is the complementary nucleotide sequence of ccgagattg?
The complementary nucleotide sequence of ccgagattg is ggctctaac.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The complementary sequence to ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta is ggatagttagaacaatgctgtgcctcatgtgctccggtataaccattaagaaactattgcaat. It pairs adenine with thymine and cytosine with guanine.
List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?
The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".
A fragment of a strand of nucleic acid isolated from a silk moth species contains the base sequence CAGACT The strand must be from?
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
