answersLogoWhite

0

DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.

User Avatar

Wiki User

11y ago

What else can I help you with?

Related Questions

What base sequence would be produced through TAGGTAACT?

The base sequence produced from the DNA strand TAGGTAACT would be its complementary strand. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary sequence would be ATCCATTGA.


An original DNA strand has the following base sequence ACGTAAGCT What base sequence would be produced through transcription?

During transcription, the DNA sequence ACGTAAGCT is translated into a complementary RNA sequence. The base pairing rules dictate that adenine (A) pairs with uracil (U) in RNA instead of thymine (T) found in DNA. Thus, the RNA sequence produced would be UGCAUUCGAA.


What base sequence would be produced through transcription ACGTAAGCT?

gaugcgauccguaaucugaccau


What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT


Which of these is the correct mRNA that would be produced from this segment of DNA tactaggctaat?

The correct mRNA sequence that would be produced from the DNA sequence "tactaggctaat" is "auguccgcuuau". This is because in mRNA, thymine (T) is replaced by uracil (U) and the complementary mRNA sequence is produced from the DNA template during transcription.


During replication which sequence of nucleotides would pair with the DNA segment ttacgc?

The DNA segment ttacgc would pair with the complementary RNA sequence aaugcg during replication. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T).


What amino acid would be produced if transcription took place from the DNA sequence CAT?

Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.


What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).


What would happen to a cell or organism if DNA did not got through replication?

If DNA did not go through replication, the cell or organism would not be able to divide and produce new cells. This would lead to cell death and ultimately to the death of the organism due to an inability to replace damaged or old cells.


How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?

The mutant strand would likely have a different amino acid sequence compared to series 1 due to the mutation in the DNA sequence. The mutant strand may result in changes in the protein structure and function if the mutation leads to a substitution, deletion, or insertion of a nucleotide in the coding region of the gene.


What is the mrna produced in a t t c g a c c t a c g?

The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.


What sequence of nucleotides would pair with the DNA segment TTACGC during replication?

During DNA replication, the sequence of nucleotides that would pair with the DNA segment TTACGC is AATGCG. This pairing occurs due to the complementary base pairing rules, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, T pairs with A, T with A, A with T, C with G, G with C, and C with G.