0
DNA replication is a semi-conservative process. The DNA is split into two strands. Nucleotides are then attached to each strand by complementary base pairing, where A attaches to T and G attaches to C. The newly formed strand is hence identical to the old strand and the base sequence of DNA can hence be conserved during replication.
What else can I help you with?
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would happen to a cell or organism if DNA did not got through replication?
If DNA did not go through replication, the cell or organism would not be able to divide and produce new cells. This would lead to cell death and ultimately to the death of the organism due to an inability to replace damaged or old cells.
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
What base sequence would be produced through transcription ACGTAAGCT?
gaugcgauccguaaucugaccau
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
Which of these is the correct mRNA that would be produced from this segment of DNA tactaggctaat?
The correct mRNA sequence that would be produced from the DNA sequence "tactaggctaat" is "auguccgcuuau". This is because in mRNA, thymine (T) is replaced by uracil (U) and the complementary mRNA sequence is produced from the DNA template during transcription.
During replication which sequence of nucleotides would pair with the DNA segment ttacgc?
The DNA segment ttacgc would pair with the complementary RNA sequence aaugcg during replication. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T).
What amino acid would be produced if transcription took place from the DNA sequence CAT?
Transcription of the DNA sequence CAT would produce the messenger RNA sequence CAU. This mRNA sequence would then be translated by ribosomes to produce the amino acid histidine.
What would happen to a cell or organism if DNA did not got through replication?
If DNA did not go through replication, the cell or organism would not be able to divide and produce new cells. This would lead to cell death and ultimately to the death of the organism due to an inability to replace damaged or old cells.
How would the amino acid sequence produced by the mutant strand compare to the amino acid sequence produced by series 1?
The mutant strand would likely have a different amino acid sequence compared to series 1 due to the mutation in the DNA sequence. The mutant strand may result in changes in the protein structure and function if the mutation leads to a substitution, deletion, or insertion of a nucleotide in the coding region of the gene.
What is the mrna produced in a t t c g a c c t a c g?
The mRNA sequence produced from the DNA sequence "ATTCGACCTACG" would be "UAAGCUGGAUGC." This is achieved through the process of transcription, where RNA polymerase reads the DNA template and synthesizes a complementary mRNA strand.
What will be produced by DNA replication if the DNA molecule is a-t-t-c-g-g-a-a-t-g-g-a-a-t-c-c-c-g?
On its own, nothing. It has no start codon (TAC). Even assuming that this is just a section in the middle of a codon, the first is a stop. It says; stop-alanine-glycine-cysteine This sequence is total nonsense.
Explain why the addition of an extra base in a DNA sequence would change the message carried by a DNA molecule?
The addition of an extra base in a DNA sequence would cause a frameshift mutation, shifting the reading frame of the genetic code. This would alter the codons specifying amino acids in the protein sequence, leading to a different protein being produced.
How would the transcription of eukaryotic gene be affected if a replication error changed the nucleotide sequence of the termination signal for that gene?
Extra long proteins are likely to fold improperly and not function correctly. The overall health of the individual would be destroyed.
If DNA aattgccgt what is its complement?
The complementary strand to yours would be ATGCAA. Just remember that T is complementary to A and C is complementary to G.
