0
If the complementary strand is made of DNA it is 3' tctacgtag 5'
If the complementary strand is made of RNA it is 3' ucuacguag 5'
Wiki User
∙ 12y ago
Wiki User
∙ 15y agoThe complementary strand is:
3' tctgataacctttgtgtacgcgga 5'
Wiki User
∙ 13y agoIt would be : tacgccgatcttataaggt
Wiki User
∙ 15y ago5'TCCGATTGGAC3'
Wiki User
∙ 14y ago3'-atgctagtata-5'
Wiki User
∙ 11y ago5' tgcacgagccatgc 3'
Wiki User
∙ 14y agoTCTACGTAG
Add your answer:
Earn +20 pts
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is attgcat complementary strand sequence?
In DNA: 5' attgcat 3' 3' taacgta 5'
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
Complementary strand of dna AAT?
Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
How many total hydrogen bonds would exist between the dna strand and its complementary strand 5'ACTCTAG 3'?
15
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is attgcat complementary strand sequence?
In DNA: 5' attgcat 3' 3' taacgta 5'
What is the complementary DNA chain of 5'-AATGSTA-3'?
Do you mean complementary DNA chain of 5'-AATGCTA-3' (not 5'-AATGSTA-3')A(adenine) bonds with T(thymine) and G(guanine) bonds with C (cytosine). So the complementary DNA strand would be: 3'-TTACGAT-5' .
What complementary strand of DNA would be produced from the strand DNA shown below?
Assuming it's 5' to 3', The complementary strand would be 3' G-A-A-T-C-C-G-A-A-T-G-G-T 5'
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
