0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the name given to the process where the DNA is copied?
DNA Replication. A C T A G G T G A T C C A C T A G G T G A T C C
T-a-c-c-a-c-g-t-g--a-c-t-g-a-g-g-a-c-t-c-c-t-c what is the transcribing sequence?
In RNA, the above code would be transcribed as:AUGGUGCACUGACUCCUGAGGAGThis is because:Adenine bonds with Uracil (In DNA, Adenine bonds with Thymine)Cytosine bonds with Guanine
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
The bases needed to replicate the bases in the question is aagctctgaatcagcctacacttcaccactaa.
When was Terrence 'T. C. ' Carson born?
Terrence 'T. C. ' Carson was born on November 19, 1958.
What is Terrence 'T. C. ' Carson's birthday?
Terrence 'T. C. ' Carson was born on November 19, 1958.
How old is Terrence 'T. C. ' Carson?
Terrence 'T. C. ' Carson is 53 years old (birthdate: November 19, 1958).
Where to find t c Carson singing funny little valentine?
You can find it on YouTube, but probably not the best ..
What are some other words for disgusting?
c u n t or c l i t
When was Thomas C. Carson House created?
Thomas C. Carson House was created in 1875.
When was Terrence C. Carson born?
Terrence C. Carson was born on 1958-11-19.
Painting signed C Carson and am trying to find out about the artist?
It's probably Caroline Carson. Go to www.google.com Type: artist C Carson It will give you lots of results. I think it may be the Korean painter Charles Carson - he always signed his paintings with C. Carson.
What has the author T Anders Carson written?
T. Anders Carson has written: 'Folding the crane' 'Different Shred of Skin (A)'
What is the mark for the Carson City mint?
the Carson city mint is "CC" for Carson City.while Carson City mint has two "CC"the mint mark for Charlotte is "C" for Charlotte.these sometimes get confused because there both "C" .the Charlotte mint has one "C"
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
