The bases needed to replicate the bases in the question is aagctctgaatcagcctacacttcaccactaa.
It's GTTCATCCGA
DNA Replication. A C T A G G T G A T C C A C T A G G T G A T C C
G-G-T-A-G-CK well i love biology :)) sooooAdenine and Thymine are paired togetherGuanine and Cytosine are also paired togetherso the complementary strand for c-c-a-t-c-g would be: g-g-t-a-g-cSources: Honors Biology at High School Level
It will be based on the process in which it involved- for replication, transcription or translation As a rule the bases will be expressed in Capital letters If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil Sreekala.K.P
In RNA, the above code would be transcribed as:AUGGUGCACUGACUCCUGAGGAGThis is because:Adenine bonds with Uracil (In DNA, Adenine bonds with Thymine)Cytosine bonds with Guanine
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
A t g t g g a a c c g t g
t a a c g g t c g
t c c g a g t c a g a t c g
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
It's GTTCATCCGA
DNA Replication. A C T A G G T G A T C C A C T A G G T G A T C C
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
C-G-A-T-T-A-G-G-C
atggttcgatggataattggc