0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is complementary to CGT AT?
In DNA, C pairs with G, and A pairs with T.This means that GCATA is complementary to CGTAT.
What would be the base sequence for the complementary DNA formed from CGT TA?
ACGGTA
CGT base triplet on DNA is copied into mRNA as?
microRNA
The DNA code is cgt what is the sequence of nucleotides in the transcribed mrna?
TCU
How are complementary of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
What is the complementary strand of ttc agt aca?
The complementary DNA strand would be TTCGTT.But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
. How are complementary strands of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What does the reaction in the test tube generate when complementary DNA is made for reading DNAen complementary?
recombinant DNA strand.
What does cmo stand for?
It stands for: Complementary Metal Oxide Semiconductor
