answersLogoWhite

0


Best Answer

3' aatgcccaggtcagtacgct 5' is the complimentary strand.

User Avatar

Wiki User

9y ago
This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What would be the complementary strand of 3 acgtgctacggtacg-5?

If the complementary strand is made of DNA it is 3' tctacgtag 5' If the complementary strand is made of RNA it is 3' ucuacguag 5'


What would the other strand of DNA be - g g t c g a a t?

5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand


Complementary strand of dna AAT?

Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?


What is the coding DNA and mrna strand for the template strand 3' a-g-g-t-t-c-a-t 5'?

The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.


In which direction does RNA polymerase read a DNA strand?

The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.


Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?

This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'


What is the complimentary strand of 5' ACCCGAAATTTG 3'?

A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'


An okazaki fragment has which of the following arrangements?

5' DNA to 3' Bipin


When DNA replicates what are the new DNA made of?

its made of DNA. Replication just doubles the DNA, just like when bacteria or humans replicate.. the new human is .. well made of human.... It is opposite and anti-parallel.... 5-AATGTC-3 Original strand 3-TTACAG-5 new strand Each new molecule will have 1 original strand, and 1 daughter/newly synthesized strand. DNA replication results in DNA DNA transcription results in a strand of RNA


What is attgcat complementary strand sequence?

In DNA: 5' attgcat 3' 3' taacgta 5'


If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?

The sequence on the strand of the helix is TACCGGATC.


Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?

3-gttcacctta-5