0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
Ifa DNA triplet is CTA then what is the complimentary DNA?
Because Cytosine attaches with Guanine and adenine attaches with thymine, if CTA (cytosine, thymine, adenine) had another strand of DNA it should read GAT however mutations can occur.
What are two names of lines that run east to west?
they are called longitude
What are four different types of mutations in chromosomes?
There are four basic types of point mutations that can occur:Substitution: This kind of mutation switches with another base to create an irregular sequence.ex:) NORMAL - ABCDEFGSUBSTITUTION - BACDEFGInsertion: This kind of mutation involves the insertion of an extra base to the sequence.ex:) NORMAL - ABCDEFGINSERTION - ABHCDEFGDeletion: This kind of mutation deletes or loses one of the bases in the sequence.ex:) NORMAL - ABCDEFGDELETION - ACDEFGFrameshifts: This kind of mutation is where a sequence has an insertion or deletion, altering it. Since the sequence is divided into three bases to each section, which are called codons, the insertion or deletion of one of the bases can alter the codons completely, creating a different sequence, known as a frameshift.ex:) NORMAL - ABC DEF GHIFRAMESHIFT - BCD EFG HIThose are the four basic types of point mutations, however there are other known mutations.translocation,substitution,insertion,deletion
What would the complementary mRNA strand be for this gene tac ttg cta act?
AUG AAC GAU UGA Please specificy 5' 3' end for more clarity
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
When DNA replication occurs before meiosis the original DNA strand CAG TGT CCG TAG is copied into complementary strand GTC CTA CGG ACA. What type of mutation has occurred?
inversion
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
If the DNA sequence is GAT what is the sequence of the complementary strand of DNA?
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
Ifa DNA triplet is CTA then what is the complimentary DNA?
Because Cytosine attaches with Guanine and adenine attaches with thymine, if CTA (cytosine, thymine, adenine) had another strand of DNA it should read GAT however mutations can occur.
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
Gatccatgagttac ctaggtactcaatg
What is the complementary strand for the sequence c t t a g g c t t a c c a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
If the DNA molecule is a-t-t-c-g-a-c-c-t-a-c-g What is the complementary strand of DNA produced?
If 5'- ATCAGACTCA -3' is the DNA template, 3'- UAGUCUGAGU -5' is the mRNA complement.Be careful: strands are always read 5' to 3'.
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
In DNA, A binds to T and C binds to G Therefore the complementary DNA sequence to 5'-GAT-CGG-TAC-AGT-G-3' is: 3'-CTA-GCC-ATG-TCA-C-5'
