answersLogoWhite

0


Best Answer

The complementary strand for CGATTAC would be GCTAATG.

C and G are always paired together, and A and T are always paired together.

User Avatar

Wiki User

14y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

9y ago
GTCCTTAAT
In DNA C bonds to G and A bonds to T.
This answer is:
User Avatar

User Avatar

Wiki User

13y ago

The complementary DNA strand would be:

ATGCATGGCATCCTA

This answer is:
User Avatar

User Avatar

Wiki User

11y ago

TGACTCGCTAGATCGATAAGGC

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What determines the sequence of the nitrogenous bases in a new DNA strand?

It's complimentary pair. C--G and T--A


The complimentary strand or matchig strand of DNA for tagtca would be?

It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.


When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?

B. Complimentary


What do the template strands of DNA always begin with?

DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!


What is the complimentary DNA base pair to ATCG?

TAGC. A pairs with T, G pairs with C.


How do you make a complimentary strand?

In DNA, complementary strands are two strands of nucleotides that base pair by hydrogen bonds across the nitrogen basses of each nucleotide is such a way that A (adenine) always pairs with T (thymine) and G (guanine) always pairs with C (cytosine). The sequences are complementary in that each strand has the pair match (complimentary) base to the other all along the strand. Dr. Claire DNA Diva


Which DNA strand can base pair with a-t-g-c-t-a?

T-A-C-G-A-T


If a DNA stand sequence tagcaagc what will be the complimentary strand?

The complimentary strand of DNA would have the sequence: tacggctagttgg


If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?

the complimentary styrand would be: T-C-C-G-A-T


Can a single DNA strand bond with another single DNA strand?

Yes this is true :) - This happens if the two strands of DNA have organic bases complimentary to one another - E.g if one strand has the Base code - TAACGATC the other strand would have the Base code - ATTGCTAG - this is because the bases pair up as so - Adenine&& Thymine and Cytosine and Guanine - this is bcause these organic bases are complimentary due to the molecular structures allowing certain number of hydrogen bonds to form between these bases - A & T have two hyrdrogen bonds and C& G have three :D xx


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is complementary base pair?

The complementary means that if you know the sequence of bases in one strand, you'll know the sequence of bases in the other strand. For example, if the base sequence of bases in one DNA strand is A-C-T, the base sequence in the complementary strand will be T-G-A, as shown here http://www.ric.edu/faculty/jmontvilo109graphicsdnaandrnadnastructure.gifit is urasil for RNA. It is adenine for DNACORRECTION.It is uracil for RNA, thymine for DNA.