The complementary strand for CGATTAC would be GCTAATG.
C and G are always paired together, and A and T are always paired together.
The complementary DNA strand would be:
ATGCATGGCATCCTA
TGACTCGCTAGATCGATAAGGC
T-A-C-G-A-T
tRNA does not copy a strand of DNA - that is what mRNA does.So for the DNA strand ATT-CGA-CCT-ACG:the mRNA strand would be UAA-GCU-GGA-UGCtRNA is responsible for carrying the correct amino acid to match up with the codon (three letter code) on the mRNA. The first codon here is UAA - which is a stop codon - meaning the peptide chain being created will not proceed beyond this.
If a DNA strand read CCTAGCT, its mRNA would read GGAUCGA.
A bonds with T and C bonds with G A and G are the purines and C and T are the pyrimidines so it'd be gtattcttcaagagatcgg= cataagaagttctctagaa that's it :]
The top strand, which is drawn 5' to 3' and which contains the promoter sequences in the conventionally written orientation (such as the TATA box) and which has the same sequence as the new RNA (except for U instead of T) is the plus strand or the sense strand or the non template strand or the coding strand. The bottom 3' to 5' strand is the minus, or template, or antisense strand. Your sequence therefore is the coding strand, but the RNA is transcribed off of the non-coding, template, or antisense strand.
It's complimentary pair. C--G and T--A
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
B. Complimentary
DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!
TAGC. A pairs with T, G pairs with C.
In DNA, complementary strands are two strands of nucleotides that base pair by hydrogen bonds across the nitrogen basses of each nucleotide is such a way that A (adenine) always pairs with T (thymine) and G (guanine) always pairs with C (cytosine). The sequences are complementary in that each strand has the pair match (complimentary) base to the other all along the strand. Dr. Claire DNA Diva
T-A-C-G-A-T
The complimentary strand of DNA would have the sequence: tacggctagttgg
the complimentary styrand would be: T-C-C-G-A-T
Yes this is true :) - This happens if the two strands of DNA have organic bases complimentary to one another - E.g if one strand has the Base code - TAACGATC the other strand would have the Base code - ATTGCTAG - this is because the bases pair up as so - Adenine&& Thymine and Cytosine and Guanine - this is bcause these organic bases are complimentary due to the molecular structures allowing certain number of hydrogen bonds to form between these bases - A & T have two hyrdrogen bonds and C& G have three :D xx
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
The complementary means that if you know the sequence of bases in one strand, you'll know the sequence of bases in the other strand. For example, if the base sequence of bases in one DNA strand is A-C-T, the base sequence in the complementary strand will be T-G-A, as shown here http://www.ric.edu/faculty/jmontvilo109graphicsdnaandrnadnastructure.gifit is urasil for RNA. It is adenine for DNACORRECTION.It is uracil for RNA, thymine for DNA.