0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
What is the complementary strand GCA AG?
CGU UC
What is the sequence of bases of the mrna for tacaaatttgcaaccact?
TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
Describe the processes of transcription and translation and correctly identify the anticodon for the following DNA template strand-acg tgg gca tga acg tgg?
mRNA - carries genetic code for protein tRNA - helps incorporate amino acids into polypeptide chains. rRNA - forms structural and functional components of ribosomes. Transcription - occurs in the nucleus of the cell. Production of mRNA from DNA. 1) Initiation - RNA polymerase recognises and binds to the specific promoter sequence and initiates transcription. 2) Elongation - RNA Polymerase moves along the template DNA strand (bottom strand) in a 3' to 5' direction, unwinding it as it goes to synthesize RNA in the 5' to 3' direction. (to create the mRNA strand) 3) Termination - RNA Polymerase encounters a transcription terminator, releases the completed mRNA strand and dissociates from the DNA. Translation - occurs in cytoplasm. Production of polypeptide chain (protein products) from mRNA. Occurs in a 5' to 3' direction. 1) Initiation - Ribosomes bind to mRNA 2) Elongation - Amino Acids (carried by tRNA) are incorporated into polypeptide chains. (Anticodons at the base of tRNA must make a perfect complementary match with the codon on mRNA before the amino acid will be released.) 3) Termination - Ribosomes, polypeptide chain and tRNA are released from mRNA. Anti-codon for DNA template strand - 3' - ACG UGG TCA UGA ACG UGG - 5'
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
What complementary strands of DNA would be produced from the strand of DNA?
Gca-tat gca ta The answer is AGC CT cat gt
What strand of DNA would be produced from from the template strand of DNA shown below?
Ttg ga
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?
Gca ta
What is the complimentary strand of GTA-GCA?
acg-att
What is the complementary strand GCA AG?
CGU UC
What would be the stand of complementary dna produced by the strand of dna shown below cgt ata?
Gca-tat gca ta The answer is AGC CT cat gt
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What is the complementary strand of ttc agt aca?
The complementary DNA strand would be TTCGTT.But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
What is mrna for dna strand atc gca gga tgc?
First, separate the letters into codons so they are easier to read: ggc tat atc ctg cgc tat acg cta Then, convert them into mrna, replacing the g's with c's, the c's with g's, the t's with a's, and the a's with u's. Unlike DNA, RNA doesn't contain t, but it can still translate t's. ccg aua uag gac gcg aua ugc gau
