answersLogoWhite

0


Best Answer

If the complementary strand is made of DNA it is 3' tctacgtag 5'

If the complementary strand is made of RNA it is 3' ucuacguag 5'

User Avatar

Wiki User

12y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

15y ago

The complementary strand is:

3' tctgataacctttgtgtacgcgga 5'

This answer is:
User Avatar

User Avatar

Wiki User

14y ago

It would be : tacgccgatcttataaggt

This answer is:
User Avatar

User Avatar

Wiki User

15y ago

5'TCCGATTGGAC3'

This answer is:
User Avatar

User Avatar

Wiki User

14y ago

3'-atgctagtata-5'

This answer is:
User Avatar

User Avatar

Wiki User

11y ago

5' tgcacgagccatgc 3'

This answer is:
User Avatar

User Avatar

Wiki User

14y ago

TCTACGTAG

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What would be the complementary strand of 3 acgtgctacggtacg-5?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

Complementary strand of dna AAT?

Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?


What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?

The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


How many total hydrogen bonds would exist between the dna strand and its complementary strand 5'ACTCTAG 3'?

15


What is the complementary DNA of atgcatgta-3'?

The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.


What is the complementary base sequence of cagttagc-oh?

A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.


What would the complementary strand of DNA be for the sequence cttaggcttacca?

GGATCGA is comlementary to the DNA strand CCTAGCT.


What is attgcat complementary strand sequence?

In DNA: 5' attgcat 3' 3' taacgta 5'


What is the complementary DNA chain of 5'-AATGSTA-3'?

Do you mean complementary DNA chain of 5'-AATGCTA-3' (not 5'-AATGSTA-3')A(adenine) bonds with T(thymine) and G(guanine) bonds with C (cytosine). So the complementary DNA strand would be: 3'-TTACGAT-5' .


What complementary strand of DNA would be produced from the strand DNA shown below?

Assuming it's 5' to 3', The complementary strand would be 3' G-A-A-T-C-C-G-A-A-T-G-G-T 5'


Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?

3-gttcacctta-5


A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?

It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.