In DNA, complementary strands are two strands of nucleotides that base pair by hydrogen bonds across the nitrogen basses of each nucleotide is such a way that A (adenine) always pairs with T (thymine) and G (guanine) always pairs with C (cytosine). The sequences are complementary in that each strand has the pair match (complimentary) base to the other all along the strand.
Dr. Claire
DNA Diva
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
AATCGCCGTTA
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
acg-att
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
lol i hate this question........its in meh science book
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
The complimentary strand of MRNA would be AAUUCCGG.