Every A would match up with a T, and every C would match up with a G. So the final result would be: tctagagctcagt. Hopefully, next time you won't have to come here for your bio answers.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
AATCGCCGTTA
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
acg-att
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
lol i hate this question........its in meh science book
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
The complimentary strand of MRNA would be AAUUCCGG.