answersLogoWhite

0

Every A would match up with a T, and every C would match up with a G. So the final result would be: tctagagctcagt. Hopefully, next time you won't have to come here for your bio answers.

User Avatar

Wiki User

15y ago

What else can I help you with?

Related Questions

WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?

AATCGCCGTTA


The complimentary strand or matchig strand of DNA for tagtca would be?

It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.


What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?

3' aatgcccaggtcagtacgct 5' is the complimentary strand.


What is the complimentary strand of GTA-GCA?

acg-att


DNA strand that would replicate tcgagaatctcgatt?

The complimentary DNA strand would be AGCTCTTAGAGCTAA.


What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?

taacgggtac


When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?

B. Complimentary


If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?

It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.


What is the complimentary strand for DNA for the sequence base of cttaggcttacca?

lol i hate this question........its in meh science book


What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?

The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.


What would be the complimentary strand of GCCATTG?

The complementary strand to GCCATTG would be CGGTAAC. Adenine pairs with thymine and guanine pairs with cytosine in DNA strands.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.