answersLogoWhite

0

a-t-g-g-a-g-c-g-t-t-g-a

A pairs with T and G pairs with C. It doesn't matter how long the strand is....it's so ******in' simple.

A-T bonds are stronger than G-C bonds. A-t rich regions of DNA are hard and don't code for many functioning genes.

G-C rich regions are where the active genes are found.

A-t Regions stain dark blue-black w/ Geimsa, Leishman's or wright's stain etc... G-C regions do not. That's how banding patterns are achieved and chromosomes can be more accurately identified.

User Avatar

Wiki User

13y ago

What else can I help you with?

Related Questions

What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT


If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?

It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What is the complimentary strand for DNA for the sequence base of cttaggcttacca?

lol i hate this question........its in meh science book


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?

taacgggtac


What determines the sequence of the nitrogenous bases in a new DNA strand?

It's complimentary pair. C--G and T--A


What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?

I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


If a DNA stand sequence tagcaagc what will be the complimentary strand?

The complementary strand to tagcaagc would be ATCGTTCG. In DNA, adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). So, the complementary bases are matched accordingly to form the opposite strand.


WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?

AATCGCCGTTA


How do you find a complimentry strand of DNA?

DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.