The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide.
Replace:
A for T
T for A
C for G
G for C
The matching is done as follows:
DNA - RNA:
A - U
T - A
G - C
C - G
If the nucleotide sequence is cggattacaaactcggctaggcttgtagggctattgttgcg How would i determine the sequence of bases in the complentary strand to the DNA template strand?
gtactcaaggtctctag
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
It would be T-A-A-G-C-C
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
DNA replication requires the opening of the 'zipped up' DNA strand. This is so a 'new' strand of DNA can be inserted and have a template strand to 'read' off. DNA polymerase analyses the bases on the template strand and adds each complementary base to synthesise the 'new' strand. In order for DNA polymerase to be able to do this the DNA has to be opened up by helicase to reveal the bases of the template strand. The unzipping of the DNA by helicase forms the replication fork. Thus the function of the replication fork is to reveal template strands for DNA replication to actually occur.
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
TCA is the complementary strand for AGT. Adenine forms double bond with thymine & guanine forms triple bond with cytosine & vice-versa
If TACGTT is read 5'-TACGTT-3' then the complimentary strand will read 5'-AACGTA-3'. Since the template strand is traditionally written in the 5' to 3' direction then the complimentary strand, written in the same manner, would be AACGTA not ATGCAA. The four bases, adenine(A), thyamine(T), cytosin(C), and guanine(G) bond together in pairs. A - T, and C - G. They do not pair with any other base unless in the case of RNA, when thyamine is replaced with uracil.
It would be T-A-A-G-C-C
DNA strands are said to be complementary because they both match up with eachother; A with T and C with G. So if you have the strand ATGGCTA the complementary strand (the other half of the double helix) would read TACCGAT. So if you know one side of the strand then you can describe the whole.
it would read: atgacgt
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
If reading the DNA in the same direction ie 5' to 3' it would be ATC, however when bound to the complement it would sit in the reverse order - 3' to 5' and would read CTA.
DNA replication requires the opening of the 'zipped up' DNA strand. This is so a 'new' strand of DNA can be inserted and have a template strand to 'read' off. DNA polymerase analyses the bases on the template strand and adds each complementary base to synthesise the 'new' strand. In order for DNA polymerase to be able to do this the DNA has to be opened up by helicase to reveal the bases of the template strand. The unzipping of the DNA by helicase forms the replication fork. Thus the function of the replication fork is to reveal template strands for DNA replication to actually occur.
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
The plus strand is the same as the sense strand and can also be called the coding or non-template strand. This is the strand that has the same sequence as the mRNA (except it has Ts instead of Us). The other strand, called the template, minus, or antisense strand, is complementary to the mRNA. Gotta love the use of 4 names to describe the same thing. Ah science, why do you torment us?
That mRNA sequence had to come from the complement to it. Remeber that the sequence is normally read 5' to 3'. The complement that produced it would be seen in the 3' to 5' orientation (reverse) during transcription. Therefore, find the complement source by reading the sequence in reverse and making the following substitutions: a becomes t, u becomes a, g becomes c, and c becomes g. The result is the following DNA source sequence read 5' to 3': ctaagtcgcaatttttggcat.
As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.