0
What are the complementary bases of a t g c c c t a t a g c g c g c a a a g a g?
Wiki User
∙ 12y ago
A binds with T, G binds with C.
Therefore the complementary strand of ATG-CCC-TAT-AGC-GCG-CAA-AGA-G is:
TAC-GGG-ATA-TCG-CGC-GTT-TCT-C
Wiki User
∙ 12y ago
Wiki User
∙ 10y agoC T(also U) C C T(also U) A G respectfully.
Add your answer:
Earn +20 pts
What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
What is the complementary strand for the sequence c t t a g g c t t a c c a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
What is the mRNA for DNA molecule t-a-c- c- g -g?
If a DNA strand read CCTAGCT, its mRNA would read GGAUCGA.
What is the DNA code for A-T-C-G-A?
C-G-A-T-T-A-G-G-C
How many nucleotides would be in the strand c c g t c a a g t a c g?
Each of these letters stands for a base (which is part of one nucleotide). Therefore because there are 12 bases, there would be 12 nucleotides in the strand.
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
t-c-t-c-c-t-a-g-t-g-g-t-t-t-t-a-a
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
What shows how bases pair in complementary strands of DNA?
A-T and C-G
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What is complementary strand of c c t a g t c a t g?
In DNA, the complementary strand would be: GGATCAGTAC.
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
Complementary DNA bases for RNA bases?
Essentially DNA replication without thymene, instead using Uracil. DNA to RNA A=Uracil C=G G=C T=A
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is Compliment of c t a g c?
On the complementary side of the DNA, it would be G A T C G
What is the complementary sequence for this DNA c-t-a-a-g-t-c?
To find the complementary sequence for a given DNA sequence, you need to match each nucleotide with its complementary base according to the base-pairing rules. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Given the DNA sequence: C - T - A - A - G - T - C The complementary sequence would be: G - A - T - T - C - A - G
How do dna bases pair up with mrna bases?
The mRNA bases are complementary to the DNA bases, and so form H-bonds when the DNA is single-stranded. DNA - mRNA A - U T - A C - G G - C
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
