0
Genetic Engineering
Questions about the manipulation of an organisms genes in order to alter the morphological or chemical traits of the organism.
1,707 Questions
Does every cell have genetic material?
No, the gametes or sex cells contain only half of the chromosomes of a body cell so the gene count would not be equal.
What kind of acid is in a molecule that carries a genetic information?
Nucleic acids:
- Deoxyribose Nucleic Acid
- Ribose Nucleic Acid
Difference between an autosomal recessive disorder and an autosomal dominant disorder?
autosomal dominant is only when one allele is messed up
autosomal recessive is when you give the disease to your child 50/50 chance.
Not true.... 50/50 when its Autosomal Dominant(see below)
- Recessive Inheritance
Both parents carry a normal gene (N), and a faulty, recessive, gene (n). The parents, although carriers, are unaffected by the faulty gene. Their offspring are affected, not affected, or carriers. This type of inheritance was first shown by Mendel.
- Dominant Inheritance
One parent has a single, faulty dominant gene (D), which overpowers its normal counterpart (d), affecting that parent. When the affected parent mates with an unaffected and non-carrier mate (dd), the offspring are either affected or not affected, but they are not carriers.
How does DNA help with the transfer of genetic material from parents to offspring?
Yes, it does. You get 23 chromosomes from your mother and 23 from your father. These chromosomes contain DNA, which is the code for making genes. Since you get DNA from your parents, you also get genes from them.
How can genetic engineering reduce the use insecticides?
Genetic Engineeringcant reduce the use of insectides. In fact, there is demonstrable evidence from the US Dept of Agriculture's own data that in fact, since the introduction of Genetic Engineering there has been an overall increase in the use of insecticides.
Its perfectly logical when one considers that the companies (E.g. Monsanto) who own the patent on the Genetically Engineered (aka Genetically Modified) plant that is resistant to herbicide/insecticide, also owns the patent rights to the herbicide/insecticide. It is in the corporations best interests to increase the use of pesticides. Think about it - why would a corporation kill the goose that lays the golden egg? It pays to remember: biotechnology companies are also the world's biggest agrichemical companies.
All organisms have a genetic code made of?
All organisms have a genetic code made of these three nucleotide sequences called codons.
What are some advantages and disadvantages of cloning as a reproductive technique?
I can list some disadvantages and they are: High failure rate, Problems during later development, Abnormal gene expression patterns and Telomeric differences which is when the chromoscones get shorter. Hope it helps because I'm still looking for advantages!
What are examples of lethal genetic disorders?
This means that you have a genetic disease where as your DNA suppresses certain proteins in your body, thus either 1: giving you a deadly mutation somewhere on the body or 2: killing you
I think?
What are the four genetic disorders?
-Insertions
-Deletions
-Replacements
-Flips
•AAATTGCTACGTCGATCGATCGGCCT
•AAATTGCTACGTCGATGATCGGCCT
•AAATTGCTAGCGTCGATCGATCGGCCT
•AAATTGCTACGTCGATCGCTCGGCCT
•AATATGCTACGTCGATCGATCGGCCT
What tends to increase genetic variation in a population?
Genetic variation is the total amount of genetic diversity present within a species or population. The amount of genetic variation in a population will depend on a variety of factors, including the size of the population, the type of reproduction, and environmental influences.
The primary way to increase genetic variation in a population is through mutation. Mutations are random changes in the genetic code that can lead to new traits or characteristics. Mutations can be caused by environmental factors, such as exposure to radiation or chemicals, or they can occur spontaneously. Mutations can be beneficial, neutral, or detrimental to the organism, but they do lead to increased genetic variation.
Another way to increase genetic variation in a population is through migration. When individuals from different populations mate, they bring with them different alleles from their home population, increasing the genetic diversity of the new population. This is especially important for populations that are geographically isolated, such as island populations.
Another factor that can increase genetic variation is sexual selection. This is the process by which individuals select mates based on certain desired traits. This can lead to an increase in the number of different alleles in the population, as individuals with certain traits will be more likely to reproduce.
Finally, gene flow is a process that can increase genetic variation in a population. Gene flow is when individuals from one population move to another population and mate with individuals in the new population. This can bring in alleles from the original population, increasing the genetic diversity of the new population.
Overall, while mutation, migration, sexual selection, and gene flow are all important factors in increasing genetic variation in a population, it is important to note that genetic variation can also be decreased by inbreeding and genetic drift. Inbreeding is when individuals mate with close relatives, reducing the number of alleles in the population and leading to decreased genetic variation. Genetic drift is when random fluctuations in allele frequencies occur due to a small population size, leading to decreased genetic variation. Therefore, it is important to consider all of these factors when trying to increase genetic variation in a population.
What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T)
The querry sequence is:
t-a-c-c-t-c-g-c-a-a-c-t
So the mRNA sequence would be:
A U G G A G C G U U G A
Genetic engineering is helping heart patients by the production of?
Genetic engineering is also helping heart patients, hemophiliacs, and patients with viruses. Through the development of anticoagulants
Is Repo the Genetic Opera a comic book?
No Repo! started as the Necromerchent's Debt written by Terrance Zdunich
Note: The book you may be thinking of is Repossession Mambo which is what the film Repo Men is based from.
Is crossing over takes place in sperms before fertilization?
Crossing over occurs during fertilization. This is the mixing of alleles from each of the parents in order to make the offspring.
What are 2 identical strands of genetic material?
Chromosomes and sister chromatids are joined strands of duplicated genetic material. A chromatid is one copy of a duplicated chromosome which, before replication, is composed of one DNA molecule.
Why is it difficult to cure a human genetic disorder?
It would require changing a person's genes. We can't do that. Yet. Until we do, the genes that gave you the disease will get passed to your children, and THEIR children, etc.
The genetic code is said to be universal because a codon represents the same?
The genetic code is said to be universal because a codon represents
the same amino acid in almost all organisms.
Is it ethical to clone a human?
Human cloning is a controversial venture and it is unlikely that it will ever be totally accepted in society.
If humans were cloned, most people would probably agree that they should be treated the same as any other human. Afterall, they can't control the way they are born, just like you or me cannot control our skin color or gender.
However, I have discussed the topic with different demographics of people to find some mixed responses. Some in the religious community say they would not let a clone into their house of worship since their god did not create them. Others say that they should be viewed as property.
However, since the world of human cloning seems to be a far off prospect now, this question will probably remain open for discussion.
I have more to add to the section above, i believe that the people with religion, are wrong, because, since god created you, and you make the clone, then therefore, god made the clone.
This is a ridiculous question. Why wouldn't they have rights and why wouldn't they have the same rights as everyone else? Just because the human didn't come from sex doesn't mean they are not human. Anyone who disagrees is superstitious and unintelligent. This will be the next form of slavery/racism. Even dogs have rights. A human is a human.
How do you think each cell gets a complete set of chromosomes?
In humans, boys get x and y but girls get xx
The spermatocytes which develop into sperm and the oocytes which develop into eggs, also called gametes are only 1N which is half the complement of a fertilized egg/conceptus.
Tetracycline is used in genetic engineerin experiments as a way to?
Produce stronger strains of bacteria
What is the genetic complement of an individual with Down syndrome?
An individual with down syndrome has one extra chromosome beyond 2N. Down syndrome is designated trisomy 21 or 47,XX+21.
