answersLogoWhite

0

🧪

Genetic Engineering

Questions about the manipulation of an organisms genes in order to alter the morphological or chemical traits of the organism.

1,707 Questions

All organisms have a genetic code made of?

All organisms have a genetic code made of these three nucleotide sequences called codons.

What are some advantages and disadvantages of cloning as a reproductive technique?

I can list some disadvantages and they are: High failure rate, Problems during later development, Abnormal gene expression patterns and Telomeric differences which is when the chromoscones get shorter. Hope it helps because I'm still looking for advantages!

What are examples of lethal genetic disorders?

This means that you have a genetic disease where as your DNA suppresses certain proteins in your body, thus either 1: giving you a deadly mutation somewhere on the body or 2: killing you

I think?

What are the four genetic disorders?

-Insertions

-Deletions

-Replacements

-Flips

•AAATTGCTACGTCGATCGATCGGCCT

•AAATTGCTACGTCGATGATCGGCCT

•AAATTGCTAGCGTCGATCGATCGGCCT

•AAATTGCTACGTCGATCGCTCGGCCT

•AATATGCTACGTCGATCGATCGGCCT

What tends to increase genetic variation in a population?

Genetic variation is the total amount of genetic diversity present within a species or population. The amount of genetic variation in a population will depend on a variety of factors, including the size of the population, the type of reproduction, and environmental influences.

The primary way to increase genetic variation in a population is through mutation. Mutations are random changes in the genetic code that can lead to new traits or characteristics. Mutations can be caused by environmental factors, such as exposure to radiation or chemicals, or they can occur spontaneously. Mutations can be beneficial, neutral, or detrimental to the organism, but they do lead to increased genetic variation.

Another way to increase genetic variation in a population is through migration. When individuals from different populations mate, they bring with them different alleles from their home population, increasing the genetic diversity of the new population. This is especially important for populations that are geographically isolated, such as island populations.

Another factor that can increase genetic variation is sexual selection. This is the process by which individuals select mates based on certain desired traits. This can lead to an increase in the number of different alleles in the population, as individuals with certain traits will be more likely to reproduce.

Finally, gene flow is a process that can increase genetic variation in a population. Gene flow is when individuals from one population move to another population and mate with individuals in the new population. This can bring in alleles from the original population, increasing the genetic diversity of the new population.

Overall, while mutation, migration, sexual selection, and gene flow are all important factors in increasing genetic variation in a population, it is important to note that genetic variation can also be decreased by inbreeding and genetic drift. Inbreeding is when individuals mate with close relatives, reducing the number of alleles in the population and leading to decreased genetic variation. Genetic drift is when random fluctuations in allele frequencies occur due to a small population size, leading to decreased genetic variation. Therefore, it is important to consider all of these factors when trying to increase genetic variation in a population.

What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?

Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T)

The querry sequence is:

t-a-c-c-t-c-g-c-a-a-c-t

So the mRNA sequence would be:

A U G G A G C G U U G A

Genetic engineering is helping heart patients by the production of?

Genetic engineering is also helping heart patients, hemophiliacs, and patients with viruses. Through the development of anticoagulants

Is Repo the Genetic Opera a comic book?

No Repo! started as the Necromerchent's Debt written by Terrance Zdunich

Note: The book you may be thinking of is Repossession Mambo which is what the film Repo Men is based from.

Is crossing over takes place in sperms before fertilization?

Crossing over occurs during fertilization. This is the mixing of alleles from each of the parents in order to make the offspring.

What are 2 identical strands of genetic material?

Chromosomes and sister chromatids are joined strands of duplicated genetic material. A chromatid is one copy of a duplicated chromosome which, before replication, is composed of one DNA molecule.

Why is it difficult to cure a human genetic disorder?

It would require changing a person's genes. We can't do that. Yet. Until we do, the genes that gave you the disease will get passed to your children, and THEIR children, etc.

The genetic code is said to be universal because a codon represents the same?

The genetic code is said to be universal because a codon represents

the same amino acid in almost all organisms.

Is it ethical to clone a human?

Human cloning is a controversial venture and it is unlikely that it will ever be totally accepted in society.

If humans were cloned, most people would probably agree that they should be treated the same as any other human. Afterall, they can't control the way they are born, just like you or me cannot control our skin color or gender.

However, I have discussed the topic with different demographics of people to find some mixed responses. Some in the religious community say they would not let a clone into their house of worship since their god did not create them. Others say that they should be viewed as property.

However, since the world of human cloning seems to be a far off prospect now, this question will probably remain open for discussion.

I have more to add to the section above, i believe that the people with religion, are wrong, because, since god created you, and you make the clone, then therefore, god made the clone.

This is a ridiculous question. Why wouldn't they have rights and why wouldn't they have the same rights as everyone else? Just because the human didn't come from sex doesn't mean they are not human. Anyone who disagrees is superstitious and unintelligent. This will be the next form of slavery/racism. Even dogs have rights. A human is a human.

How do you think each cell gets a complete set of chromosomes?

In humans, boys get x and y but girls get xx

The spermatocytes which develop into sperm and the oocytes which develop into eggs, also called gametes are only 1N which is half the complement of a fertilized egg/conceptus.

What is the genetic complement of an individual with Down syndrome?

An individual with down syndrome has one extra chromosome beyond 2N. Down syndrome is designated trisomy 21 or 47,XX+21.

How are genetic events related to probability?

Probability is related to inheritance because in Mendel's experiments, the probabilities were important. Each time Mendel repeated the cross, he observed that the principles of probability applied to his experiment.

Is hybridization an example of genetic engineering?

Hybridization is crossing two varieties of the same or similar species through pollination or other natural methods to create a new variety. Genetic engineering is the process of artifically inserting a gene from one species into another species to create a new trait, such as inserting a bacteria gene into corn to create resistance to a pesticide. So, though some consider them to be the same, they are not. Hybridization is a completely different process than genetic engineering.

What is H12C6O6 also called?

it is glycerol, a component of fats.

IUPAC name would be: propane-1,2,3-triol

What are some risks of cloning?

1. First you might die quicker 2.You have another you spying hiding here and there 3.You and the clone might get mixed up and if your clone have broke many laws they might think its you 4.It's called "Playing God" witch christians hate 5.You clone might try to kill you 6. There are thousands more but i cant stay here writing till im 100 years old