It uses the same procedure as adult DNA cloning to start with. The created embryo will be allowed to grow for around 2 weeks. Its stem cells would be taken and encouraged to grow into a human organ.
In humans the risk of passing on a genetic disorder to offspring can be assessed by?
You could make a pedigree which could identify carriers of a genetic disorder and individuals with the disorder. You could do blood tests to determine whether a person carries a gene for a particular genetic disorder. You could make a karyotype to determine whether there are any chromosomal abnormalities.
Why do common patterns of genetic control for development exist in animals?
They exist because all these genes have descended from the genes of common ancestors.
What is evolutionary significance in describing the genetic code as nearly universal?
They believe that the DNA / RNA?
It just means that life appeared only once on Earth and was the basis of DNA into RNA. Only reinforces the fact that we are all related, had a common ancestor. Some "life", such as prions, the cause of the disease BSE, have no DNA / RNA, but still managed to reproduce so that the quasi-universality of the genetic code.
How does mutation contribute to genetic variation?
Think of it this way: When an animal is born with a deformity or mutation, sometimes that variation turns out to be beneficial for it's survival. Maybe it can reach farther, hold more in it's mouth, hold it's breath longer, move faster because of longer legs, etc.
Any mutation that allows a creature to live longer, be more attractive to the opposite sex or produce more offspring has the ability to modify the general characteristics of a region or group or species of animals over a long time. An animal that lives longer simply has MORE TIME to have sex and more opportunities to pass on it's traits. If an animal can defend itself better because of a variation, it will live longer. If an animal can get more food because of a longer tongue, bigger mouth, longer arms, stronger grip, etc. it will live longer. If an animal has more prominent features because of a deformity and it turns out to be attractive to the opposite sex, then they will have MORE sex and pass on their traits to MORE babies. Good mutation = more sex = more babies = more good mutations. Simple as that. Picture a family tree and imagine that characteristic passed along.
Theoretically By cloning A plant or animal you end up with a copy of the original plant or animal. For instance if you were to clone all beef cattle from parents that gave terrific beef industry could alway be assured of the quality of a given strain of beef. this would be of great advantage to the growers of meat. The same can be said for the growers of plants and fruit uniformity in quality is very important when it cums to the bottom line.
What are some important processes involved in genetic engineering?
Transgenesis, which is the process of replicating DNA from one organism and inserting it into the DNA of another, creating what is called recombinant DNA
What are all the genetic diseases?
iwen the system of the Intel coris allowed to enter the womb bye bye the answer is actually wrong its cos im bored
Why is genetic engineering a source of controversy?
While some people might fear genetic engineering because it is impossible to know what effects modifying genes will have in the long-term, because their religious convictions cause them to believe that modifying what God made will bring about bad results, or for other reasons, not all who oppose genetic engineering do so because of fear. Some believe it is simply common sense not to mix genes of different species together like is done with the genetic modification of crops. Some have even discovered results of research that suggests genetic engineered crops are causing negative effects on the environment, so there are genuine concerns that are not based on fear that need to be seriously considered.
What are two types of vector used in recombinant DNA technology?
there are many different vectores as:
1-plasmid system
2-bacteria phage lamda
3-cosmids
4-bacterio artificial system
5-puc system
the other cloning vectors are
m13 which is the oldest one.
and after the above all are:-
BAC(bacterial artificial chromosome)
YAC(yeat artificial chromosome)
TAC(transformation-competent artificial chromosome)
Do dogs get genetic disorders?
Yes. Dogs (and every other species with DNA) can get a genetic disorder. This can be due to inheriting a disorder from a parent, or by a copying error from a parent, such as a mutation or a DNA sequence being dropped, duplicated, reversed, etc. Of course, we know much more about human genetic disorders than dog disorders. Sometimes a "disorder" is actually an advantage under some circumstances, which explains why some disorders are preserved through history, such as sickle-cell anemia in humans (helps one survive malaria).
A change in the genetic material of a cell is called?
Cancer- certain mutations (changes) in a cell's genetic material may cause that cell to reproduce with out control.
I think it's called recombinant technology
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.
For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
What is the name of the specific molecule to which each base is attached?
They are attached to a deoxyribose sugar.
How do you clone an orchid from a cutting?
Depending upon which type of orchid, tree or ground, they are both easy to propagate. A tree orchid will send out an aerial root, cut the stem just below the root and plant in a container. For a terrestrial orchid, obtain the pseudobulb and place in a suitable soil container.
What process is called when a organism is changed from the genetic material from another organism?
The process is called nuclear transfer and the resulting product is a GMO, (Genetically modified organism)
What is the outward appearance of an individual due to its genetic make up called?
It is known as their genome.
What is a human genetic disorder caused by a dominant gene is?
One example is Huntington's Disease. Carried on a dominant gene, it causes deterioration of the central nervous system, affecting movement, swallowing, personality, etc.
What role do play people in genetic engineering?
cells contain the genatic substances or better known as the chromosomes which gives a person his character, shape size and everything.
What is a scope of genetic engineering in Pakistan?
unfortunately in Pakistan there is not much scope of genetic engineering however abroad researches in this field of science are conducted on vast scales and job opportunities and research work abroad is also excellent and good.
in Pakistan genetic engineering is still in its premature phase and if you like me are interested in genetic enginnering then you should consider to go abroad for study and other work related to it