Genetic Engineering

What do you mean by one area? If by one area you mean does it start at one area then stop and continue on another area then no, DNA replication is continuous and when it takes place it is the most important thing going on in the cell. The cells resources are directed at this process * DNA replication means copying the entire DNA molecule, so it involves the entire molecule, but not all at the same time. In bacteria (prokaryotic cells) replication begins at one point in the molecule and continues all the way round the circular molecule.

Beginning at just one place would take too long in eukaryotic cells; someone has calculated that our longest chromosomes would take about a fortnight to replicate, and we cannot wait that long! So replication begins at a number of sites along the length of the DNA molecule. At each replication site, as the DNA strands are separated there is a bulge in the molecule called a replication bubble. As replication proceeds these bubbles become longer, and eventually they merge into one another and the job is done.

A plasmid vector available today is made with a specific host in mind. For example, if you decide to express a gene in a bacteria, there will be plasmids available with features that suit the particular organism that you wish to transform and they will be different from plasmids used to transfect for example, yeast. However, generally, a plasmid will have at the very least an origin of replication recognizable by the desired organism, a promoter upstream of the multiple cloning site that is recognizable by the organisms, and a selection marker such as an antibiotic resistance gene.

The process of expressing a gene from one organism in another host via plasmid vectors begin with the isolation of the gene from the original organism. For the sake of this example, suppose the insulin gene in humans is the gene of interest. First, beta cells from the Islets of Langerhans will have to be lysed and total RNA will be isolated from the cell. Because DNA is filled with many introns that are hard to get rid of, gene isolation from higher eukaryotes almost always start from the mRNA stage because the introns were already sliced out in mRNA processing. The RNA will be then subjected to reverse-transcriptase polymerase chain reaction with primers specific for the insulin gene. The insulin gene will subsequently be selectively amplified and the reaction mixture can then be purified to contain only cDNA of the insulin gene.

With the purified cDNA, a process called molecular cloning is used to get the gene into the plasmid. The plasmid and the gene are both cut with compatible restriction enzymes. The cuts on the plasmid has to be in the multiple cloning site the the cuts on the gene has to be outside of the open reading frame for the cloning to produce an effective vector. (Review molecular biology for the necessity of promoters and an intact open reading frame) The cut plasmid and gene fragments are then placed together and ligated. The ligated product should theoretically now contain the gene inside the multiple cloning site directly following the promoter. The promoter may express the gene constitutively or it may be inducible, requiring certain conditions to be met before it is turned on.

The plasmid with the cloned insulin gene can now be transformed into competent bacteria hosts (or yeast if desired, however it will not be as efficient). Competence describes the ability of bacteria to take up DNA from its surroundings. The most commonly used host, E. coli, are artificially made to be competent by treatment with a high concentration calcium solution in a cold environment, while others, such as B. subtilis, are naturally competent. All bacteria can be made competent with electroporation but E. Coli is most often used because of its easily satisfied nutrient requirements and very short generation time. The plasmid and competent E. coli is placed together in a cold environment to initiate the uptake of the plasmid into E. coli cells. The mixture is then heat shocked and bacterial growth medium with the necessary selection agent is added to start the incubation process. If the selection marker on the plasmid is an antibiotic resistance gene, for example ampicillin resistance, a medium with ampicillin will be used to incubate the bacterial culture because only the cells that contain the plasmid will be resistant to the antibiotic while cells that have failed to take up the plasmid will die. The cells can then be incubated for as long as needed and split into different cultures if needed because they now contain the plasmid and will express the gene carried on the plasmid.

• A plasmid can be considered as a suitable vehicle for cloning, because

  1. It can be isolated from the cells

  2. It possesses a single restriction site for one or more restriction enzymes.

  3.Insertion of a linear molecule at one of these sites does not alter its replication properties.

  4.Reinsertion of these vectors to the host cell can identified and selectable.

  5.They do not occur free in nature and found in bacterial cells.

• Ex: for plasmid cloning vectors are pBr322,pACYC18,pUC,pUN121.

No because it changes letters so the primer will not be the correct match. They have to be different.

For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.