answersLogoWhite

0

🧪

Genetic Engineering

Questions about the manipulation of an organisms genes in order to alter the morphological or chemical traits of the organism.

1,707 Questions

How can cloning be used?

Theoretically By cloning A plant or animal you end up with a copy of the original plant or animal. For instance if you were to clone all beef cattle from parents that gave terrific beef industry could alway be assured of the quality of a given strain of beef. this would be of great advantage to the growers of meat. The same can be said for the growers of plants and fruit uniformity in quality is very important when it cums to the bottom line.

What are some important processes involved in genetic engineering?

Transgenesis, which is the process of replicating DNA from one organism and inserting it into the DNA of another, creating what is called recombinant DNA

What are all the genetic diseases?

iwen the system of the Intel coris allowed to enter the womb bye bye the answer is actually wrong its cos im bored

Why is genetic engineering a source of controversy?

While some people might fear genetic engineering because it is impossible to know what effects modifying genes will have in the long-term, because their religious convictions cause them to believe that modifying what God made will bring about bad results, or for other reasons, not all who oppose genetic engineering do so because of fear. Some believe it is simply common sense not to mix genes of different species together like is done with the genetic modification of crops. Some have even discovered results of research that suggests genetic engineered crops are causing negative effects on the environment, so there are genuine concerns that are not based on fear that need to be seriously considered.

What are two types of vector used in recombinant DNA technology?

there are many different vectores as:

1-plasmid system

2-bacteria phage lamda

3-cosmids

4-bacterio artificial system

5-puc system

the other cloning vectors are

m13 which is the oldest one.

and after the above all are:-

BAC(bacterial artificial chromosome)

YAC(yeat artificial chromosome)

TAC(transformation-competent artificial chromosome)

Do dogs get genetic disorders?

Yes. Dogs (and every other species with DNA) can get a genetic disorder. This can be due to inheriting a disorder from a parent, or by a copying error from a parent, such as a mutation or a DNA sequence being dropped, duplicated, reversed, etc. Of course, we know much more about human genetic disorders than dog disorders. Sometimes a "disorder" is actually an advantage under some circumstances, which explains why some disorders are preserved through history, such as sickle-cell anemia in humans (helps one survive malaria).

A change in the genetic material of a cell is called?

Cancer- certain mutations (changes) in a cell's genetic material may cause that cell to reproduce with out control.

Could DNA be amplified with only one primer?

No because it changes letters so the primer will not be the correct match. They have to be different.

For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.

How do you clone an orchid from a cutting?

Depending upon which type of orchid, tree or ground, they are both easy to propagate. A tree orchid will send out an aerial root, cut the stem just below the root and plant in a container. For a terrestrial orchid, obtain the pseudobulb and place in a suitable soil container.

What process is called when a organism is changed from the genetic material from another organism?

The process is called nuclear transfer and the resulting product is a GMO, (Genetically modified organism)

What is a human genetic disorder caused by a dominant gene is?

One example is Huntington's Disease. Carried on a dominant gene, it causes deterioration of the central nervous system, affecting movement, swallowing, personality, etc.

What role do play people in genetic engineering?

cells contain the genatic substances or better known as the chromosomes which gives a person his character, shape size and everything.

What is a scope of genetic engineering in Pakistan?

unfortunately in Pakistan there is not much scope of genetic engineering however abroad researches in this field of science are conducted on vast scales and job opportunities and research work abroad is also excellent and good.

in Pakistan genetic engineering is still in its premature phase and if you like me are interested in genetic enginnering then you should consider to go abroad for study and other work related to it

3 ways that the society portrayed in the movie gattaca routinely read a person genetic proflie?

Scans people eyes for vision. Collects blood before able to enter certain buildings. Urine test for hiring.

What cell structure is made up of the genetic material?

Chromosomes are long, wound up strands of the genetic material, DNA.

What are the potential advantage and disadvantages of genetic engineering?

advantages :

1. Disease could be prevented by detecting people/plants/animals that are genetically prone to certain hereditary diseases, and preparing for the inevitable. Also, infectious diseases can be treated by implanting genes that code for antiviral proteins specific to each antigen.

2. Another of genetic engineering is that diseases could be prevented by detecting people that are genetically prone to certain hereditary diseases, and preparing for the inevitable. As well as preventing disease, with genetic engineering infectious diseases can be treated by implanting genes that code for antiviral proteins specific to each antigen

3. Animals and plants can be 'tailor made' to show desirable characteristics. Genes could also be manipulated in trees for example, to absorb more CO2 and reduce the threat of global warming.

4. Genetic Engineering could increase genetic diversity, and produce more variant alleles which could also be crossed over and implanted into other species. It is possible to alter the genetics of wheat plants to grow insulin for example.

5. Another advantage of genetic engineering is that animals and plants can be made to have desirable characteristics which could help solve some of the world's problems. For example in trees, genes could be manipulated to absorb more carbon dioxide. This would help reduce global warming, and thus solve one of the biggest problems earth faces.

disadvantages.

1. Nature is an extremely complex inter-related chain consisting of many species linked in the food chain. Some scientists believe that introducing genetically modified genes may have an irreversible effect with consequences yet unknown.

2. Genetic engineering borderlines on many moral issues, particularly involving religion, which questions whether man has the right to manipulate the laws and course of nature.

3. Another reason why people think that using genetically modified crops and plants is a disadvantage is that they think it will increase our reliance on pesticides, which have a harmful effect on the environment.

4. Another disadvantage of Genetic Engineering is Genetic engineering borderlines on many moral issues, particularly involving religion, which questions whether man has the right to manipulate the laws and course of nature. Also it brings into question Darwin's theory of "the survival of the fittest", if this theory has worked over the last 20 centuries , why change it? ...

experimental 'breakthroughs' made possible by genetic engineering.

1. At the Roslin Institute in Scotland, scientists successfully cloned an exact copy of a sheep, named 'Dolly'. This was the first successful cloning of an animal, and most likely the first occurrence of two organisms being genetically identical. Note : Recently the sheep's health has deteriorated detrimentally

2. Scientists successfully manipulated the genetic sequence of a rat to grow a human ear on its back. (Unusual, but for the purpose of reproducing human organs for medical purposes)

Most controversially, and maybe due to more liberal laws, an American scientist is currently conducting tests to clone himself.

What do the genetic codes xx and xy mean?

There are 22 autosomal chromosomes and 2 sex chromosomes in humans. In all the other chromosomes, the homologous pairs match up genetic loci. However, in human sex chromosomes the X and Y chromosome are different (with the X chromosome being much larger and the Y chromosome carrying genes that cause "maleness").

Someone with an X and a Y chromosome is a male because he has a Y chromosome that carries the genes that code for "maleness". Females "lack" this Y chromosome, and thus show characteristic female phenotypes.