0
Biochemistry
Biochemistry is the study of the structure, composition and chemical processes in all living organisms. It covers the structures and functions of various cellular components, including proteins, carbohydrates, nucleic acids, lipids, and other biomolecules.
8,065 Questions
What is the structure of N-serine in a neutral solution?
Serine is found in several configurations: L-serine, beta-Hydroxyalanine, (S)-Serine, 56-45-1, L-ser, (S)-2-Amino-3-hydroxypropanoic acid and D-ser.
It is a non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE.
HO2CCH(NH2)CH2OH.
(2S)-2-amino-3-hydroxypropanoic acid
D-Serine, synthesized in the brain by serine racemase from L-serine (its enantiomer), serves as a neuromodulator by coactivating NMDA receptors, making them able to open if they then also bind glutamate. D-serine is a potent agonist at the glycine site of the NMDA-type glutamate receptor.
D-serine was only thought to exist in bacteria until relatively recently; it was the second D amino acid discovered to naturally exist in humans, present as a signaling molecule in the brain, soon after the discovery of D-aspartate.
D-Serine is being studied in rodents as a potential treatment for schizophrenia and L-serine is in FDA-approved human clinical trials as a possible treatment for ALS
What is the amino acid responsible for the Hopkins-cole reaction?
The amino acid responsible for the Hopkins-Cole reaction is the tryptophan because of its indole ring that in the reaction forms a violet color upon treatment of the sample with glyoxylic acid and sulfuric acid.
A gibbane ring is a type of plant growth hormone or compounds containing a gibbane ring system, e. g. gibberellin.
What type of vitamins are in pears?
Pears are a good source of vitamin C and vitamin K. They also contain small amounts of other vitamins such as vitamin E, B vitamins, and folate.
Why a starved liver has less glycogen then a well fed liver?
The blood-glucose level begins to drop several hours after a meal, leading to a decrease in insulin secretion and a rise in glucagon secretion; glucagon is secreted by the α cells of the pancreas in response to a low blood-sugar level in the fasting state. In same way,insulin signals the fed state, this fed condition leads to the secretion of insulin, which is one of the two most important regulators of fuel metabolism,the secretion of the hormone insulin by the β cells of the pancreas is stimulated by glucose. It stimulates glycogen synthesis in both muscle and the liver and suppresses gluconeogenesis by the liver.
What hormone is most responsible for preparing the uterus for pregnancy?
Name of this hormone is estrogen.
How do lipids work in the body?
One example is the lipid bilayer found in every cell in your body. It is part of the cell membrane. The lipids have a polar head and two little tails that attach onto the tails of another lipid, which is why it's a bi (meaning two) layer. Lipids are fats and they are hydrophobic. This lipid bilayer can help fight osmosis (the natural process of water trying to balance itself between the inside and outside of the cell) so that the cell doesn't get filled with water and break or get its water sucked out so that it collapses upon itself. It also can help keep other objects outside of the cell.
Also, fats are stored because they can be used to burn energy. There are simple sugars and complex sugars. Fat is one type of fuel for the body.
What is the meaning of mono in monosaccharide?
The prefix "mono" in monosaccharide means "one" or "single." It indicates that a monosaccharide is the simplest form of sugar, consisting of a single sugar molecule. Common examples include glucose and fructose, which cannot be hydrolyzed into simpler sugars. In contrast, polysaccharides are made up of multiple monosaccharide units.
Will boiling sugar turn it from mainly sucrose to dextrose?
Effect of acid and heat on sugar
Sucrose (table sugar) is a disaccharide, meaning it is two simple sugars, glucose and fructose, that have reacted in such a way that they join together, losing a molecule of water in the process. A reaction that produces water is called a condensation reaction. The fructose acts like an acid, and donates a proton. The glucose acts like a base, and donates a hydroxide ion. The proton and the hydroxide ion combine to form water, and the two simple sugars combine to form sucrose.
The reverse reaction, called hydrolysis, is where a water molecule is added to a molecule to break it into two parts. Hydrolysis of sucrose in water happens very slowly all by itself. But if an acid is added, it acts like a catalyst, promoting a faster reaction, but not getting used up in the process. Heating up the solution makes the reaction go even faster.
The result of heating sucrose in water with a little lemon juice or vinegar in it is that much of the sucrose is converted into the two simple monosaccharides. Since fructose is a lot sweeter than sucrose, the result is a sweeter solution, even though glucose is not quite as sweet as sucrose. Since the acid is not used up, the solution is also a little tart, but that can be fixed by adding a weak base like egg whites or baking soda. If there are proteins in the solution, they can also react with the acid to neutralize it.
What is the process of egg formation called?
The process of egg formation in females is called oogenesis. It involves the maturation and development of immature egg cells (oocytes) in the ovaries.
Is vitamin b soluble in ch2cl2?
Vitamin B is a group of water-soluble vitamins, so it is not soluble in CH2Cl2, which is a nonpolar solvent. The polar nature of water makes it a better solvent for water-soluble vitamins like Vitamin B.
How do you make bacteriostatic water?
You can add little chlorine to the water to make it bacteriostatic. You can find the chlorine in the water for months together, keeping it bacteria free. The pure water can not be stored for long and can be contaminated with bacteria, any time. The risk of chlorinated water being carcinogenic is theoretical, rather than practical. When you drink the water, most of the chlorine is eaten up by food in the stomach and by the mucous lining of the stomach. The advantages of chlorine in water are far more than the disadvantages. Because the chlorine is very economical, there is no godfather for the same.
Why water is a buffer solution?
Pure water has a pH of 7, meaning its neutral. So it helps neutralize acids and bases.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
Essential fatty acids are essential for your health and must be.....?
Essential fatty acids are essential for your health and must be consumed in foods. They cannot be synthesized by the body.
What makes up 65 percent of the human body?
Oxygen is about 65% of the human body by mass.
Oxygen is in many biological molecules, but most of it is in water.
Water by itself can be 65% of the mass of a human. (It varies with age, gender, muscle and and body fat, but is 55-65% for adults and more for children.)
Numerically, hydrogen atoms represent 65% of all atoms in the human body.
That varies too, because many of the hydrogen are abound up in water and water content varies.
As one can see, many things are 65% of the human body.
The temperature needs to be high enough to denature the DNA strands but not too high to cause inactivation of the enzyme. The temperature must also allow the enzyme to bind to the DNA strands during annealing for optimal activity. Maintaining the enzyme's stability and functionality throughout the temperature cycles is critical for successful PCR amplification.
What is the meaning of the different colors in Benedict's test?
The different colors in Benedict's test represent the varying levels of reducing sugars present in a solution. A blue color indicates no reducing sugars present, while green, yellow, orange, and red colors indicate increasing levels of reducing sugars, with red being the highest concentration.
What are examples of fat-soluble vitamins are?
Examples of fat-soluble vitamins are vitamins A, D, E, and K; vitamin D, for example, is derived from cholesterol, which is also fat soluble.
