answersLogoWhite

0

📱

Computer Programming

A category for questions about computer programming and programming languages.

10,506 Questions

How do you generate binary sequence for a decimal sequence?

No one on this site will know how do this. It's far too complicated, as for me I think you need to figure out how to do this yourself.

How do you shutdown a computer using command prompt?

Before shutting down your system Close all open file and folders. Follow these step:-

1. Click start Button or Windows Logo Left bottom corner

2. Click Shut Down.

Or you can use also shut down using CTRL ALT Delete button. or need any assistant call Techvedic expert.

What are computer spreadsheet programs?

There are several spreadsheet programs available. The most well known is probably Microsoft Office Excel. However, Open Office has a spreadsheet which has open source code and is available free under a GNU license from Sun Microsystems (see link below).

A spreadsheet is a program that allows the user to enter data in a tabular format (with columns and rows) and then perform various calculations and other manipulations on that data. For example, a user might enter a column of sales figures and instruct the software to total that column. Later, if the user wishes to change a value already entered, remove a value or add a new value, the spreadsheet will recalculate automatically without requiring the user to re-enter all of the values.

Spreadsheets can be used for anything from basic accounting to complex data analysis including graphs, statistics, and regressions. Spreadsheets can also sort data, for example alphabetizing a list of inventory.

Other contributors have said:
  • An electronic spread sheet is when we work in the Ms- Excel Then they have made the Books the combination of the Books is called an electronic Spread sheet. Because it runs on the computer so its called electronic spreadsheet programs.

What is the purpose of constructor in object oriented programming?

A constructor in a class is one of the first pieces of code to be executed when you instantiate a class. The purpose of constructors is to have code that initialize the class and prepare the variables that may be required by the class...

Write a program in C language to implement the apriori algorithm?

JavaScript is one program that has been written in C to implement the Apriori algorithm. There are also several other known programs available on the Internet that implement it as well.

How do you make a dedication in a case study?

I dedicate this research work to my subject teacher who never failed to teach and guide me, to my family who supports me in everything, to my friends who helped me finished this project, and most of all to the Almighty God who gives me strength and good health while doing this.

Explain the differences between C Language and C plus plus Language?

i want a c programme....if i have a collection of alphabhate appox 2000 or

more...alphabates r repeted...

i want to write a prograam such that first 7 terms r wrriten in first

line then next 7 alphabets r writen in next line..

not fully clear ??

i would give u an example: TTCATCATTCCTAATATTTTTCTTGTAGTTGTTTTAAAAAAGGAATTAAC

ATCCAATATTCTGTATTACATACTGTACACCAGATTTTGATTTCAGAAAA

CAATATTTGATGTATAACTTCCACTTAATTTAAATTTAATAAACTTTTAT

TTCAGAGATATTTGATTAGTTTACAATCTAAGAGTTATTCTTAAGAGTTT

CAGTGGAATTTTCTTAATTTTTCTAAAGATATTCCTACTCTCTTGATCAT

ATTCTAAGTACATATGAGTACATGTACATTCTTATACAATGTCTAAATGG

GTTAGAAAATTATTATACCTATAGAAGCGAAACTTGGAAATTAATAGAAT

CACTTAAACCAAAATCTTTATAAGACACAATTCTATTGATTTTAAAGCTT

CTGCTTTCCAGGCTCTGTTTTCCAGAGTTTATAATTACGTAGTTTTTAGT

AGATGAAAATAATGGATTCTTGTACCTAACATTTTATCCTCTTAGATCTA

AGAGCCGAAGCTATAGAACTTTGTTAGACTATTTGGCAAGCAAAATATAT

GACAGTAAATATCAGAATTTTATGGTTTGACCAGCGCTTATCACATTCCC

AATTCAGTGAGAAAAATTCATCTGGGACACAACAGGGTACTCTTCTCTGT

TTGCCCAGAATCAGCTCTGGATTTTAAGCCCAGACTTCAGTGGACCCAGA

TAGAAAATATAAAGTCTCTGATCTATAGGCCACATCAGGATGTTATTTTA

TGAAGAGTTCTAGAGCAAGGTTGCGGAAATCGGGGTGGAGATGGGGAGCA

GTGACTCCTCCAAATATTCATTGCTAACAGGCCATTCTATGCAGTTTGTT

TTAACAAATCCTGGGTTAAACTGAGGCCACAGGACATGATGGGCTGTTCT

ATAAAGCATTCTAAGTGGAGAGGAGACGATAGGGCATATGAAATTCACTA

AACTCTCTGGAAAAAAAATATGTATATATTAAAAACCAAGACTGGAATCA

GTGCAACAGTGGGAACTACCTTTTACAAGTATCCATTGCTTCATAAACTC

CATTTGTTTGGACCAATCCCTTAAACAAAAGCAAGGCAAATTTTACATGG

ATTTAGAGCCTAGGTCAGGTTATTAGGATTATAAATTTTCCACTGGTATG

TCATTGTGATTATCTTTGTTTTTGTCTTTCTGAAAGATTGGATTTTCTAT

AACACCTTGTGTAAGAAAATAAAAAACTTGATCTAACTGAA suppose this is a sequence...

i want to write first 7 alphabets in first line...(1st to seventh)

TTCATCA

next 7 in next line...(2nd to ...8th)

TCATCAT

next 7(3rd to 9th)....and so on.... can u help me to write this programm.... if u write this programm u get a treat from me....

How do you use a graphing calculator?

go to youtube.com and type same question in it's search box you will get your answer

Is computer Essentials the same as computer programming?

No. Computer essentials relate to the basic hardware knowledge (identifying input/output devices, the processor and storage devices), operations and general usage (executing and using programs such as a word processor and a spreadsheet) and file maintenance (organising, saving and deleting user documents). Computer programming requires skill and knowledge that exceeds the basic requirements of computer essentials.

Why Assembly language used on video games?

Usually for quite simple things, that take a single command in a higher-level language, it takes several lines of assembly language. Also, it is much less portable than higher-level languages, meaning that you program for one specific type of computer chip (CPU).

How do you write a basic program find whether number is even or odd if even display its square and if odd display its cube?

Divide that number into 2 using modulus division. Modulus division get the remainder of the division. If it has no remainders, then it's an even number. If not, then it's an odd number. Here's a pseudo code of the program.

ALGORITHM ODD_EVEN

INPUT (number)

IF (number MOD 2 == 0) THEN

DISPLAY ("Even")

ELSE

DISPLAY ("Odd")

END IF

END ODD_EVEN

Amendment: You did ask for a BASIC program:

10 INPUT X: IF X = 999 THEN STOP

20 PRINT X;: IF X/2 = INT(X/2) THEN PRINT "EVEN" ELSE PRINT "ODD"

30 GOTO 10

How has technology positively affected human life?

Life has great effect of technology. There is not any specific effect on life, it depends on how the technology is being used. If we use the technlogy in destrutive way then it is the most harmfull way for human life. And if we use for welfare of people then it can prove as boon to man kind. According to me technology is endless field of creations and inventions.

What Programming Language was Windows OS created and why?

Microsoft Windows Was Created By Using C, C++, Visual BASIC

What is passes in sorting algorithm?

Assuming you're talking about comparison-based sorting algorithms, the number of passes is the number of comparisons that the algorithm makes internally while sorting. In a programming language, this would be the total number of times the loop executes. This number is defined by the computational complexity (Big-O notation), which defines an upper bound.

How do you print a string using putchar?

You would iterate over all characters within the string, printing each character with the putchar function. In C, strings are terminated with a null byte, so you'd stop when that null byte has been reached.

Example:

void printme(const char* me) {

while (*me) {

putchar(*me++);

}

}

Needless to say this method is inefficient compared to using API that outputs the entire string at once, but the general approach of iterating over all characters in a string is used frequently.

What is the definition of manual accounting?

manual accounting means making records of transactions in record books rather than computers.

What is a benefit of server side programming?

Centralization- access, resources, and data security are controlled through the server

Scability - any element can be upgraded when needed

Flexibility - new technology can be easily integrate into the system

User friendly - familiar point and click interface

Hope this helps!

Inclus.net - We provide individual and corporate IT training

Educate, Learn & Serve

Can you stack a cone?

yes

add. Strictly speaking, a geometric cone is a solid. But 'ice cream cones' will stack.

Similarly, a circle is the disk bounded by the curved line, NOT the curved line.

What is floating point in computing?

Decimal Cases * * * () * () In programming, a floating point number is expressed as . In general, a floating-point number can be written as
where * M is the fraction mantissa or significand. * E is the exponent. * B is the base, in decimal case . Binary Cases As an example, a 32-bit word is used in MIPS computer to represent a floating-point number: 1 bit ..... 8 bits .............. 23 bits representing: * The implied base is 2 (not explicitly shown in the representation). * The exponent can be represented in signed 2's complement (but also see biased notation later). * The implied decimal point is between the exponent field E and the significand field M. * More bits in field E mean larger range of values representable. * More bits in field M mean higher precision. * Zero is represented by all bits equal to 0: Normalization To efficiently use the bits available for the significand, it is shifted to the left until all leading 0's disappear (as they make no contribution to the precision). The value can be kept unchanged by adjusting the exponent accordingly. Moreover, as the MSB of the significand is always 1, it does not need to be shown explicitly. The significand could be further shifted to the left by 1 bit to gain one more bit for precision. The first bit 1 before the decimal point is implicit. The actual value represented is
However, to avoid possible confusion, in the following the default normalization does not assume this implicit 1 unless otherwise specified. Zero is represented by all 0's and is not (and cannot be) normalized. Example: A binary number can be represented in 14-bit floating-point form in the following ways (1 sign bit, a 4-bit exponent field and a 9-bit significand field): * * * * * with an implied 1.0: By normalization, highest precision can be achieved. The bias depends on number of bits in the exponent field. If there are e bits in this field, the bias is , which lifts the representation (not the actual exponent) by half of the range to get rid of the negative parts represented by 2's complement. The range of actual exponents represented is still the same. With the biased exponent, the value represented by the notation is:

Note: * Zero exponent is represented by , the bias of the notation; * The range of exponents representable is from -126 to 127; * The exponent (with all zero significand) is reserved to represent infinities or not-a-number (NaN) which may occur when, e.g., a number is divided by zero; * The smallest exponent is reserved to represent denormalized numbers (smaller than which cannot be normalized) and zero, e.g., is represented by: Normalization: If the implied base is , the significand must be shifted multiple of q bits at a time so that the exponent can be correspondingly adjusted to keep the value unchanged. If at least one of the first q bits of the significand is 1, the representation is normalized. Obviously, the implied 1 can no longer be used. Examples: * Normalize . Note that the base is 4 (instead of 2)
Note that the significand has to be shifted to the left twobits at a time during normalization, because the smallest reduction of the exponent necessary to keep the value represented unchanged is 1, corresponding to dividing the value by 4. Similarly, if the implied base is , the significand has to be shifted 3 bits at a time. In general, if , normalization means to left shift the significand q bits at a time until there is at least one 1 in the highest q bits of the significand. Obviously the implied 1 can not be used. * Represent in biased notation with bits for exponent field. The bias is and implied base is 2.
The biased exponent is , and the notation is (without implied 1): or (with implied 1): * Find the value represented in this biased notation: The biased exponent is 17, the actual exponent is , the value is (without implied 1):
or (with implied 1):
Examples of IEEE 754: * -0.3125
The biased exponent is , * 1.0
The biased exponent is , * 37.5
The based exponent: , . * -78.25
The biased exponent: , * As the most negative exponent representable is -126, this value is a denorm which cannot be normalized: by GAURAV PANDEY & VIJAY MAHARA..........

AMRAPALI INSTITUTE...................

Can you say that the hackers are the good people and crackers are the bad people?

For all intents and purposes, there are indeed good and bad hackers when considering all the modern definitions of hackers, but the answer one would get to this question depends on whom you ask. In general, there are four categories of hackers. Each category attempts to generally convey the moral compass of that group relative to themselves and everyone else, as well as provide a basic backdrop of information on that category.

The first category of hackers are those for whom the term 'hacking' was originally defined. In this category, you have the hackers that perform the art in order to improve their knowledge of technology. They are curious about how systems work, and all of their attempts at penetration and exploits are merely expressions of this curiosity. Any damage caused is coincidental, or, if intentional, is based on revenge and not simple exploitation of innocent bystanders. Hackers were often classified by types, such as hardware hackers, computer hackers, phone hackers, etc.


In general, this category of hackers will not acknowledge the remaining three types of hackers as such. They consider the second form of hackers to be 'crackers', the third form as 'security consultants', and the fourth form as 'criminals.' This category only recognizes the classic definition of hacking, and so all hacking is good. Most everyone else, except possibly whitehats, are likely to see this category as bad due to the negative media coverage of crackers.


The second category of hackers were called crackers at large, until the media had a confusion over the various terms and simply lumped anyone that did something unusual with technology as hackers, mutating the term. Crackers are those that generally 'crack' things, such as breaking through firewalls, reverse engineering copyright protection so they can sell illegal copies, and the like; they have the same basic skills as hackers, but have a darker side to their motives.


Classic hackers generally hated the media for smearing their reputation by lumping in these malicious individuals with themselves. At some point, crackers also started using the term 'hackers' for themselves, thus further cementing the definition of hacker as 'one who does bad things with computers.' These crackers see themselves as good, or at least morally gray, and do not generally see any difference between their activities as compared to classic hackers, but are classified as bad by almost everyone else.


The third category of hackers are called whitehat hackers. Individuals in this category are a branch from the classic hackers on the 'good' side of morality. While classic hackers might say that this new group of hackers sold out on their heritage, whitehat hackers are out to make the world a better place, and line their pockets at the same time. Whitehats generally appeared after the appearance of blackhats; they seem to have appeared from the classic hacker community in response to a threat with the promise of monetary gain for their troubles.


These hackers will penetrate systems, document the flaws, and then sell this information to the organizations they have penetrated. They won't generally do so until they've been contracted by the organization to perform this work, which makes their otherwise illegal activities legal. They are essentially employed hackers for the good of humanity. Classic hackers are likely to see them as bad, having discarded their disdain for corporate greed, and blackhats see them as enemies, while the rest of the world see them as good.


The fourth category of hackers are called blackhat hackers, and represent the other side of the for-profit hacker community. They are generally crackers that have gone to the next level of the art of criminal activity. While crackers might break copyright protections for personal gain, blackhats are more interested in the big pot of gold at the end of the rainbow. Rather than sell a few lousy DVDs or cracked games, these hackers break into databases and steal millions of credit card numbers, or grab bank account numbers and transfer money out of them covertly, and other such activities.


Blackhats and whitehats are directly opposed to each other, with the good trying to defend companies against the bad. Neither group are generally interested in hackers or crackers, except possibly as recruits for their respective trades. Everyone considers this group bad, except for themselves; since most of them have little sense of morality, they usually simply exist, although some might acknowledge they are bad or have a sense of doing good by claiming that their hacker mentality against corporate greed drove them to relieve those corporations of their money. Blackhats, however, will work together for greater gains from their activities.


As one can tell, 'good' and 'bad' are relative to whom the question is asked, and even their very definitions differ even within the same group and from other groups.

Do compiled programs usually run faster because they are already in machine code?

No it is because compiled programs are scared so they run like stink.

Plus, uncompiled programs, ie. source programs, do not run at all... neither slowly nor fast.