0
Genetic Engineering
Questions about the manipulation of an organisms genes in order to alter the morphological or chemical traits of the organism.
1,707 Questions
What evidence if any is there to support the theory that Noah's Ark was a DNA bank?
There is no evidence, so it is not a theory. It doesn't even make any sense. It's just trying to make up an excuse for the bible by sounding sciencey
A portion of chromosome containing some genetic information is deleted during nuclear division. this is called genetic deletion.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
Is cardiac hypertrophy genetic?
Some cases of hypertrophy are due to genetics, while others are acquired later in life. The genetic form is called hypertrophic cardiomyopathy, whose prevalence is 1/500 individuals. There are several causes, most (if not all) of which are due to defects in the genes that encode certain proteins that control contraction of heart muscle.
Acquired cardiac hypertrophy usually refers to hypertrophy of the ventricles, most commonly the left ventricle. Left ventricular hypertrophy is most commonly due to excess work being placed on the left side of the heart. In the United States, a common source of this excess work is high blood pressure (hypertension).
Preparation of 1 percent agarose gel or How to prepare 1 percent agarose gel?
Check the answer for
How do you make an electrophoresis gel?
Genetic carriers
How mutation can lead to change in population over time?
with the theory of natural selection, darwin proved that it is all down to "the survival of the fittest" meaning, that the strongest of a species will always be the last to die off, therefore it has more chance of reproducing and handing its genes down.
Micro DNA is a segment of DNA that has about 25 base pairs repeated roughly 1000 times.
What are the 4 divisions of horticulture?
There are not four but a total of eight:
Arboriculture
Floriculture
Landscape Horticulutre
Oenology
Olericulture
Postharvest Physiology
Viticulture
How does process of crossing over increase the diversity within a sexually reproducing species?
in crossing over the gens present on chromosomes forms linkage so the character are exchange & thus it lead to recombination of genes that affect genetic diversity
DNA Manipulation
This may have been the result of a "mistake". Mules (a hybrid) have been around for thousands of years.
Offspring of someone with altered lung cells will inherit the normal CFTR gene.
