0
Genetic Engineering
Questions about the manipulation of an organisms genes in order to alter the morphological or chemical traits of the organism.
1,707 Questions
How do you make and interpret Punnet squares for Autosomal and sex-linked traits?
The simplest type of Punnet square is a 2x2 square. You split up the alleles for mother and father and place them on the sides of the large square. Then you "drop" them to determine the possible genotypic and phenotypic ratios. For example, if the mom is Aa and the dad is Aa as well, then using the square, the possible combinations will be AA, 2 Aa, and aa. In this case, assuming A is the dominant allele, then there will be a 3:1 ratio of dominant phenotypes to recessive phenotypes. The genotype ratio will be 1:2:1, indicating 1 homozygous dominant, 2 heterozygous and 1 homozygous recessive genotypes.
This can be done for sex linked traits too. Use XX and XY for the parents and make the same box. For example, if it is an X linked recessive disorder and it is between XY and XX' then the possible outcomes are XX, XX', XY and X'Y. Here there is a 1/2 chance that the child, regardless of gender will be normal, 1/4 that the child (girl) will be normal but a carrier and 1/4 that the child (boy) will be affected.
How do you cut ice then put it back together?
Simply apply pressure to the two pieces that you just cut and they will fuse back together.
== Answer
== You can cut ice with a saw, and as long as the two edges are just slightly melted, if you put it back together and re-freeze, it will stay together!
What is the basic unit of heredity?
The basic unit of heredity is the gene, which is a segment of DNA that contains the instructions for a particular trait or characteristic. Genes are passed from parents to offspring and determine an individual's genetic makeup.
Why are only 9 types of aneuploids known in newborns?
Most types of aneuploids are lethal early in development so therfore only 9 are passed to newborns
What is the purpose of genetic mapping?
Genetic mapping is mapping genes to a specific location on a chromosome. therefore the purpose is that it helps to tell where on the chromosome a mutation is. For example if scientists find were on a chromosome a gene for a certain mutation, they can conduct gene therapy to replace it with a normal version of that gene. Basically it just tells scientists the location of a mutation so they can fix it more efficiently.
What evidence if any is there to support the theory that Noah's Ark was a DNA bank?
There is no evidence, so it is not a theory. It doesn't even make any sense. It's just trying to make up an excuse for the bible by sounding sciencey
A portion of chromosome containing some genetic information is deleted during nuclear division. this is called genetic deletion.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
Is cardiac hypertrophy genetic?
Some cases of hypertrophy are due to genetics, while others are acquired later in life. The genetic form is called hypertrophic cardiomyopathy, whose prevalence is 1/500 individuals. There are several causes, most (if not all) of which are due to defects in the genes that encode certain proteins that control contraction of heart muscle.
Acquired cardiac hypertrophy usually refers to hypertrophy of the ventricles, most commonly the left ventricle. Left ventricular hypertrophy is most commonly due to excess work being placed on the left side of the heart. In the United States, a common source of this excess work is high blood pressure (hypertension).
Preparation of 1 percent agarose gel or How to prepare 1 percent agarose gel?
Check the answer for
How do you make an electrophoresis gel?
Genetic carriers
